Template:SBB12 part sbb1223

From OpenWetWare
Revision as of 01:42, 13 February 2012 by Jonathan Kotker (talk | contribs)
Jump to navigationJump to search
Partname:     sbb1223
Featurename:  caff_VHH
Genename:     n/a
Source:       synthetic
Construction of pBca9525-sbb1223 part

Run PCA1 on sbb1223-o01-sbb1223-o12                     (pca1pdt)
Run PCA2 on pca1pdt with sbb1223-o01 and sbb1223-o12    (397bp, pcrpdt)
Digest pcrpdt                                           (NheI/BamHI, 381+10+6, L, pcrdig)
Digest pBca9525-Bca1834                                 (NheI/BamHI, 3494+841, L, vectdig)
Ligate pcrdig and vectdig                               (3875bp, pBca9145-sbb1204)
-------------------------------------------------------------------------------
> sbb1223-o01
CCATAGCTAGCAGCAGTTGATCTGGTGAAGTTCAGTTGCAGGCTTCTGGTGG
> sbb1223-o02
ACGCAGAGAACCACCAGCCTGAACCAGACCACCACCAGAAGCCTGCAACTG
> sbb1223-o03
GGCTGGTGGTTCTCTGCGTCTGTCTTGCACCACTTCTGGTCGTGCCGGTAC
> sbb1223-o04
GAGCCTGACGGAACCAAGCCATAGAGTAGATGGTACCGGCACGACCAGAAG
> sbb1223-o05
GCTTGGTTCCGTCAGGCTCCGGGTAAAGAACGTGAGTTCCTGGCTACCGTTGG
> sbb1223-o06
CAGAGTCCATGTAGTAGGTGATACCAGAAGACCAACCAACGGTAGCCAGGAACTCA
> sbb1223-o07
GTATCACCTACTACATGGACTCTGTTAAAGGTCGTTTCACCATCTCTCGTGACAAC
> sbb1223-o08
GAGAGTTCATCTGCATGTAAGCAGAGTTTTTAGCGTTGTCACGAGAGATGGTGAAACG
> sbb1223-o09
TCTGCTTACATGCAGATGAACTCTCTGAAACCGGAAGACACCACTGTTTACTACTGC
> sbb1223-o10
GTCGTAACCAACAGAGTAAGCACGGGTAGTGGTGCAGTAGTAAACAGTGGTGTCTTC
> sbb1223-o11
CGTGCTTACTCTGTTGGTTACGACTACAGGGGTCAGGGTACCCAGGTTACCG
> sbb1223-o12
CTGATGGATCCTTAGTGAGAAACGGTAACCTGGGTACCCTG
> sbb1223
AGCAGTTGATCTGGTGAAGTTCAGTTGCAGGCTTCTGGTGGTGGTCTGGTTCAGGCTGGTGGTTCTCTGCGTCTGTCTTGCACCACTTCTGGTCGTGCCGGTACCATCTACTCTATGGCTTGGTTCCGTCAGGCTCCGGGTAAAGAACGTGAGTTCCTGGCTACCGTTGGTTGGTCTTCTGGTATCACCTACTACATGGACTCTGTTAAAGGTCGTTTCACCATC
TCTCGTGACAACGCTAAAAACTCTGCTTACATGCAGATGAACTCTCTGAAACCGGAAGACACCACTGTTTACTACTGCACCACTACCCGTGCTTACTCTGTTGGTTACGACTACAGGGGTCAGGGTACCCAGGTTACCGTTTCTCACTAA

You will need to synthesize this one using PCA with full E. coli codon usage. What it encodes is a VHH domain of an evolved Camelid antibody. The family of animals including llamas make unusual single-heavy-chain antibodies. When just the business portion of the molecule is employed, it's called a VHH domain. This particular one has been shown to dimerize in response to caffeine (PMID 19572722).

You need to read the paper, its supporting information, and the one it references (PMID 16808459) to figure out the exact peptide sequence you want. This may be easier said than done. If you get stumped, let me know. I do have more sequence info about what we want, but you should try first to figure it out.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.