Template:SBB12 part sbb1228: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
Line 7: Line 7:
The simple peptide ASASASAS*
The simple peptide ASASASAS*
{{SBB12_homodimerizer}}
{{SBB12_homodimerizer}}
<blockquote style="background: white; border: 1px solid rgb(117, 174, 255); font: typewriter; padding: 2em;"><tt>
 
<blockquote style="background: white; border: 1px solid rgb(117, 174, 255); font: typewriter; padding: 2em;">
===Construction File===
===Construction File===
tba
<pre>
</tt></blockquote>
Wobble dc5003/dc5004          (64bp, wobpdt)
Digest wobpdt                  (NheI/BamHI, L, wobdig)
Digest pBca9525-Bca1839        (NheI/BamHI, L, vectdig)
Ligate wobdig + vectdig        (pBca9525-sbb1228)
----
>dc5003  Forward construction of AS repeat and linker
CCATAgctagcGGCAGTGGATCTGGTGCTTCTGCTTCTGCT
>dc5004  Reverse construction of AS repeat and linker
CTGATGGATCCTTAAGAAGCAGAAGCAGAAGCAGAAGCACCAG
>wobpdt
CCATAgctagcGGCAGTGGATCTGGTGCTTCTGCTTCTGCTTCTGCTTCTTAAGGATCCATCAG
</pre></blockquote>
__NOTOC__
__NOTOC__

Latest revision as of 19:44, 13 February 2012

Partname:     sbb1228
Featurename:  [AS]4
Genename:     n/a
Source:       Synthetic

The simple peptide ASASASAS*

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

Wobble dc5003/dc5004           (64bp, wobpdt)
Digest wobpdt                  (NheI/BamHI, L, wobdig)
Digest pBca9525-Bca1839        (NheI/BamHI, L, vectdig)
Ligate wobdig + vectdig        (pBca9525-sbb1228)
----
>dc5003   Forward construction of AS repeat and linker
CCATAgctagcGGCAGTGGATCTGGTGCTTCTGCTTCTGCT
>dc5004   Reverse construction of AS repeat and linker
CTGATGGATCCTTAAGAAGCAGAAGCAGAAGCAGAAGCACCAG
>wobpdt
CCATAgctagcGGCAGTGGATCTGGTGCTTCTGCTTCTGCTTCTGCTTCTTAAGGATCCATCAG