Template:SBB12 part sbb1231

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (00:52, 15 February 2012) (view source)
(Construction File not correct yet, not ordered)
 
Line 13: Line 13:
<blockquote style="background: white; border: 1px solid rgb(117, 174, 255); font: typewriter; padding: 2em;">
<blockquote style="background: white; border: 1px solid rgb(117, 174, 255); font: typewriter; padding: 2em;">
-
===Construction File not correct yet, not ordered===
+
===Construction File===
<pre>PCR ca998/rdoSOECI_TM-R  on pBca9145-jtk2768         (cifrag, 583bp)
<pre>PCR ca998/rdoSOECI_TM-R  on pBca9145-jtk2768         (cifrag, 583bp)
PCR rdoSOETM_PhoA-F/g00101 on pBjh1601CK-Bjh2128 (phofrag, 1327bp)
PCR rdoSOETM_PhoA-F/g00101 on pBjh1601CK-Bjh2128 (phofrag, 1327bp)

Current revision

Partname:     sbb1231
Featurename:  cI-TM
Genename:     cI, other
Source:       Lambda phage / other

This one is a little different. You aren't putting a homodimer onto ToxR; you're building out a different homodimerization system. In this experiment, you are trying to reproduce some experiments based on PMID 9671551. In their study, they append different dimerizing transmembrane (TM) segments to the lambda repressor DNA binding domain fragment (cI') and see whether CI's activity is restored. In one case, they discuss making fusion proteins such as:

 Nterm-cI'-linker-TM-PhoA-Cterm

That would be a nice construct to have because you can do 2 assays with it: transcriptional repression from cI-dependent promoters, and periplasmic targetting with alkaline phosphatase.

Your design of this part depends on your reading of the paper and the availability of materials from which you could construct the things they describe. You'll probably want to discuss the design of your part with JCA after you have read and made sense of the paper. Your final construct should be a normal BglBricks part in plasmid pBca9525. You most likely will want to piece the part together from two (or more) pcr products. The cI construct can be amplified from pBca9145-jtk2768. You can get PhoA from plasmid pBjh1601CK-Bjh2128.

Construction File

PCR ca998/rdoSOECI_TM-R  on pBca9145-jtk2768	        (cifrag, 583bp)
PCR rdoSOETM_PhoA-F/g00101 on pBjh1601CK-Bjh2128	(phofrag, 1327bp)
PCR ca998/g00101 on cifrag+phofrag                      (pcrpdt_sbb1231, 1890bp)
Digest pBca9525-Bca1834				        (EcoRI/BamHI, L, vectdig)
Digest pcrpdt_sbb1231				        (EcoRI/BamHI, L, pcrdig)
Ligate pcrdig and vectdig, product is pBca9525-sbb1231
----
>rdoSOECI_TM-R   Combining CI'head and MalF TM
CCAACCAGCAGACCCAGCAGACCCAGAACAGACCATTTACGTTTAGATCCgcttacccatctctccgcatc
>rdoSOETM_PhoA-F  Combining MalF TM with PhoA
CTGCTGGGTCTGCTGGTTGGTTACCTGGTTGTTCTGATGTACGGATCTtctagaATTGATGCCCTGCCGCTGAC
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGTTAATGCTAGCTCAGTCCTAGGGACTCTGCTAGCGGATCTAGACATAAAAACGGCAAAGTATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTGCAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCGGATCTAAACGTAAATGGTCTGTTCTGGGTCTGCTGGGTCTGCTGGTTGGTTACCTGGTTGTTCTGATGTACGGATCTTCTAGAATTGATGCCCTGCCGCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGGGTGAAAACCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTCGACCGCGGAGTTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGGACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCAATGACGCGATTCCCACGCTGGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCGCGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTACAGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAGGCGCTGAACACCAAAGATGGCGCGGTGATGGTCATCAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAGCTGCGCATCGCCGCTTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCGATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGTAATGGATCTAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTAGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAAT
Personal tools