Template:SBB12 part sbb1231

Partname:     sbb1231
Featurename:  cI-TM
Genename:     cI, other
Source:       Lambda phage / other

This one is a little different. You aren't putting a homodimer onto ToxR; you're building out a different homodimerization system. In this experiment, you are trying to reproduce some experiments based on PMID 9671551. In their study, they append different dimerizing transmembrane (TM) segments to the lambda repressor DNA binding domain fragment (cI') and see whether CI's activity is restored. In one case, they discuss making fusion proteins such as:

 Nterm-cI'-linker-TM-PhoA-Cterm

That would be a nice construct to have because you can do 2 assays with it: transcriptional repression from cI-dependent promoters, and periplasmic targetting with alkaline phosphatase.

Your design of this part depends on your reading of the paper and the availability of materials from which you could construct the things they describe. You'll probably want to discuss the design of your part with JCA after you have read and made sense of the paper. Your final construct should be a normal BglBricks part in plasmid pBca9525. You most likely will want to piece the part together from two (or more) pcr products. The cI construct can be amplified from pBca9145-jtk2768. You can get PhoA from plasmid pBjh1601CK-Bjh2128.

Construction File

N'-  CI'-KRK-MalF_TM-Nhe1-PhoA-  C'
Primary Features of Design
 
Fragment Construction
PCR rdoP_rffGH-F/rdoSOEPro_CI-R on PBca9525-Bca1834	(A, 381)
PCR rdoSOEPro_CI-F/rdoSOECI_TM-R on PBca9145-jtk2768	(B, 449)
Wobble rdoSOECI_TM-F/rdoSOETM_PhoA-R 			(C, 125)
PCR rdoSOETM_PhoA-F/rdoPhoA-R on PBjh1601CK-Bjh2128	(D, 1100)
 
SOE reactions
PCR rdoP_rffGH-F/rdoSOECI_TM-R on A+B			(E, 784)
PCR rdoSOECI_TM-F/rdoPhoA-R on C+D			(F, 1170)
PCR rdoP_rffGH-F/rdoPhoA-R on E+F			(pcrpdt_sbb1231, 1906)
 
 
Digest PBca9525-Bca1834				(EcoRI/BamHI, 2472+1863, L, vectdig)
Digest pcrpdt_sbb1231				(EcoRI/BamHI, 1891+15, L, pcrdig)
 
Ligate pcrdig and vectdig			(pBca9525-sbb1231)
 
________________________________________________________
>rdoP_rffGH-F   Cloning of P_rffGH
GAATTCATGAGATCTCTCATTAATAAACTGGCAATG
 
>rdoSOEPro_CI-F   Combining Promoter_rffGH and CI'head
GTGAGTACTGATCTCATCAGGGATCTatgagcacaaaaaagaaacc
>rdoSOEPro_CI-R   Combining Promoter_rffGH and CI'head
ggtttcttttttgtgctcatAGATCCCTGATGAGATCAGTACTCAC
 
 
>rdoSOECI_TM-F   Combining CI'head and MalF TM
gatgcggagagatgggtaagcGGATCTAAACGTAAATGGTCTGTTCTGGGTCTGCTGGGTCTGCTGGTTGG
>rdoSOECI_TM-R   Combining CI'head and MalF TM
CAGAACAGACCATTTACGTTTAGATCCgcttacccatctctccgcatc
 
 
>rdoSOETM_PhoA-F  Combining MalF TM with PhoA
GTTACCTGGTTGTTCTGATGTACGGATCTgctagcATTGATGCCCTGCCGCTGAC
>rdoSOETM_PhoA-R  Combining MalF TM with PhoA
GTCAGCGGCAGGGCATCAATgctagcAGATCCGTACATCAGAACAACCAGGTAACCAACCAGCAGACCCAGCAGAC
 
>rdoPhoA-R   Cloning of PhoA
CTCGAGttaGGATCCCGGCCCGTAAGCGGCGATGC
>pcrpdt