Template:SBB12 part sbb1232

From OpenWetWare
Revision as of 22:00, 13 February 2012 by JCAnderson (talk | contribs)
Jump to navigationJump to search
Partname:     sbb1232
Description:  ToxR-CI'
Genename:     cI
Source:       Lambda phage

We already have a construct with ToxR-linker-cI(wt) in it, pBca9525-Bjc0005. You are going to construct the truncation mutant of this construct. You want the version of CI in which just the N-terminal DNA binding domain remains. This mutation is described in PMID 10411275.

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCR ca998/gfRevPR on pBjk2741-jtk2801	    	(160bp, A)
----
>ca998	Forward external annealing for purification of P_R part
gtatcacgaggcagaatttcag
>osbb1232R
CTGTAggatccGCTTGGCTTGGAGCCTGTTGG
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTCTCATTAATAAACTGGCAATGACCAAGACCAATGACGATTTCTTCGAAATGATGAAACGCTCATAAATTTGTCTTATGCCAAAAACGCCACGTGTTTACGTGGCGTTTTGCTTTTATATCTGTAATCTTAATGCCGCGCTGGCGATGTTAGGAAAATTCCTGGAATTTGCTGGCATGTTATGCAATTTGCATATCAAATGGTTAATTTTTGCACAGGACTGGTGGGTTTGGAACGGACTTTCCCTTCTGAATAAAGGTCTTCGTGGTTATACTTCTGCTAATAATTTTCTCTGAGAGCATGCATTGTGAATTTACTGACAGTGAGTACTGATCTCATCAGGGATCTGCCACGCACAAAACTACGGTAGCAAATGTTCGGATTAGGACACAACTCAAAAGAAATCTCGATGAGTCATATTGGTACTAAATTCATTCTTGCTGAAAAATTTACCTTCGATCCCCTAAGCAATACTCTGATTGACAAAGAAGATAGTGAAGAGATCATTCGATTAGGCAGCAACGAAAGCCGTATCCTTTGGCTGCTGGCCCAACGTCCAAACGAGGTAATTTCTCGCAATGATTTGCATGACTTTGTTTGGCGAGAGCAAGGTTTTGAAGTCGATGATTCCAGCTTAACCCAAGCCATTTCGACTCTGCGCAAAATGCTCAAAGATTCGACAAAGTCCCCACAATACGTCAAAACGGTTCCGAAGCGCGGTTACCAATTGATCGCCCGAGTGGAAACGGTTGAAGAAGAGATGGCTCGCGAAAACGAAGCTGCTCATGACATCTCTCAGCCGGAGTCCGTCAATGAATACGCAGAATCAAGCAGTGTGCCTTCATCTGCTACCGTAGTGAACACACCGCAGCCAGCCAATGTCGTGGCGAATAAATCGGCTCCAAACTTGGGGAATCGACTGTTTATTCTGATAGCGGTCTTACTTCCCCTCGCAGTATTACTGCTCACTAACCCAAGCCAATCCAGCTTTAAACCCCTAACGGGATCTGCTAGCGGAAGCGGATCGACCAAGAAAAAGCCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTGCAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCACAACCAAAAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGCGGATCCTACAG