The BioBricks Foundation:BBFRFC12: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(New page: <pre> Draft Standard for Biobrick BB-2 Biological Parts Tom Knight 19 November 2008 This standard defines the requir...) |
(No difference)
|
Revision as of 16:39, 19 November 2008
Draft Standard for Biobrick BB-2 Biological Parts Tom Knight 19 November 2008 This standard defines the required sequence properties for a Biobrick(R) BB-2 standard biological part. It does not define any functional characteristics of the parts, nor does it motivate any aspect of these standards. All sequences defined herein are specified in the 5' to 3' direction. 0. A Biobrick BB-2 compatible standard biological part consists of a DNA fragment potentially conveying informational or functional properties to a composite structure assembled from multiple parts. The current assembly process requires certain sequence properties for the part and the surrounding DNA. 1. Allowed sequences within Biobrick BB-2 parts include any DNA sequence which does not contain the following subsequences: EcoRI site: GAATTC SpeI site: ACTAGT NheI site, GCTAGC PstI site: CTGCAG NotI site: GCGGCCGC Additionally, there are a set of sites which, if convenient, should also be eliminated. Parts containing these sites qualify as fully Biobrick BB-2 standard compliant, but future assumbly and advanced uses of the parts may be compromised. These include: PvuII site: CAGCTG XhoI site; CTCGAG AvrII site: CCTAGG XbaI site: TCTAGA SapI site: GCTCTTC and GAAGAGC 2. Biobrick BB-2 Suffix Each Biobrick BB-2 part must contain precisely this sequence immediately following the 3' end of the part: GCTAGC GCGGCCG CTGCAG (note: if constructing a primer, this sequence must be reverse complemented.) 3. Biobrick BB-2 Prefix: Each Biobrick BB-2 part must contain precisely the following sequence immediately 5' of the part: GAATTC GCGGCCGC ACTAGT 4. Plasmid context Biobrick BB-2 parts must be supplied in plasmids compatible with registry and assembly procedures. The pS2Bxxxx series of plasmids comply with these requirements. Other plasmids may be compliant with the following constraints: a. Antibiotic resistance: All plasmids must carry at least one of the following antibiotic resistance markers: Ampicillin Chloramphenicol Kanamycin Tetracycline It is acceptable for a plasmid to convey both ampicillin resistance and no more than one additional antibiotic resistance markers. Note that certain strains convey resistance as well. Parts delivered to the registry must be in strains which do not convey resistance to these markers. b. Sequencing primers The registry uses the following primers in sequencing all parts. Plasmids which omit or misplace these primers cannot be sequenced: VF2: TGCCACCTGACGTCTAAGAA VR: ATTACCGCCTTTGAGTGAGC 5. Strains The registry maintains parts libraries in frozen bacterial cultures, and encourages submissions in this form. The bacterial strain must be a K-12 cloning strain (endA-). Under no circumstances will the registry accept submissions in any strain which is not BSL-1. We recommend strains such as Top10, DH10B, and DH5a. We do not recommend submissions in MC4100, BL21 and similar strains. 6. PCR contruction of Biobrick parts Biobrick BB-2 parts can be constructed by PCR from naturally occurring coding regions or other long DNA sequences. The recommended primer sequences for PCR of these fragments are: Biobrick BB-2 PCR prefix: GTTTCTTC GAATTC GCGGCCGC ACTAGA <18-24 bp of matching primer> Biobrick BB-2 PCR suffix: GTTTCTTC CTGCAG CGGCCGC GCTAGC <18-24 bp of matching primer (reverse complement). The reverse complement of this suffix sequence is: GCTAGC GCGGCCG CTGCAG GAAGAAAC This the forward sequence at the end of the PCR product 7. Assembly Scar The assembly scar left with standard BB-2 assembly is the six base sequence GCTAGT. As codons, this translates (in frame) in the universal code as Ala-Ser. ------------ Biobrick(R) is a registered trademark of the Biobricks Foundation, Inc.