Tiffany Guo

About me

Name: Tiffany Guo
Course/Minor: 20/5
Year of Graduation: 2009
Email: tiffguo
Current Classes: 5.03, 6.00, 20.109, 21F.108

Module 1: Genome Engineering

Day 1: Start up Genome Engineering

protein	function	re-engineering ideas
I	assembly	modify gene to that multiple channels can be made, and thus mature phage secretion is accelerated
II	replication of DNA + strand	modify so it can nick foreign DNA (e.g. the E. Coli's) and the phage can replicate and package a portion of the host DNA
III	phage tail protein (5 copies)	modify end of protein so that it can bind to other cells (and infect other cells) besides E. Coli
IV	assembly	modify gene to that multiple channels can be made, and thus mature phage secretion is accelerated
V	binds ssDNA	allow it to sequester double stranded DNA also, then it can be used as a vector for infecting cells with desired DNA fragments.
VI	phage tail protein (5 copies)	delete to learn more about its function.
VII	phage head protein (5 copies)	delete to learn more about its function.
VIII	phage coat protein (2700 copies)	tag it (perhaps with flourescence) to learn more about phage coat assembly
IX	phage head protein (5 copies)	modify so that it can act similarly to pIII
X	DNA replication	make pX more active so that more + strands will accumulate, allowing the host cell to produce even more phages.
XI	assembly	modify gene to that multiple channels can be made, and thus mature phage secretion is accelerated

Day 4: Genome Refactoring

I refactored the phate genome to remove overlaps in the genome and to add in restriction enzyme sites between each part. I edited codons to retain amino acid sequence while weakening the rbs or promoter. Considerations: 1) eliminate rbs and promoters within genes: took into consideration codon changes that would not change amino acid sequences but would decrease the strength of the rbs or promoter. 2) add restriction sites between each part: tried to keep sticky ends as consistent as possible (i.e. after every promoter, the restriction site sticky end is 3'ctag), however, there aren't enough zero cutting isoschizomers

On the parts registry, my part is BBa_M31975.

New Parts: a) restriction enzyme sites

restriction enzyme	code	parts number
Acc65I	G^GTAC_C	BBa_M31997
AvrII	C^CTAG_G	BBa_M31994
AscI	GG^CGCG_CC	BBa_M31990
BsiWI	C^GTAC_G	BBa_M31996
SpeI	A^CTAG_T	BBa_M31992
BssHII	G^CGCG_C	BBa_M31989
BsrGI	T^GTAC_A	BBa_M31995
MluI	A^CGCG_T	BBa_M31988
BclI	T^GATC_A	BBa_M31987
EagI	C^GGCC_G	BBa_M31986
BglII	A^GATC_T	BBa_M1985
NheI	G^CTAG_C	BBa_M31993
PspOMI	G^GGCC_C	BBa_M31984
EcoRI	G^AATT_C	BBa_M31983
XbaI	T^CTAG_A	BBa_M31991
NotI	GC^GGCC_GC	BBa_M31982
MfeI	C^AATT_G	BBa_M31976

b) Trancription terminator

part number	code
BBa_M31977	tacaattaaaggctccttttggagcctttttttt

c) coding sequences:

gene	parts number	parts removed	# bp changed	code (bp changed are capitalized)
5	BBa_M31981	rbs 7, restriction site BsrGI	3	atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattc actgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagc cagcctatgcgcctggtctgtaTaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgt ctgcgcctcgttccAgctaaCtaa
7	BBa_M31980	rbs 9, promoter 8	6	atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgtAgtactGtgtttcgcgctGggCat TatcgctgggggCcaaagatga
9	BBa_M31978	rbs 8	1	atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgttt aatggaaacttcAtcatga

DNA	Mock	1/2 DNA
[[