Tk:Ab hac una re

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Ab hac una re)
Line 34: Line 34:
EcoRI does not cut this sequence.
EcoRI does not cut this sequence.
 +
 +
 +
Sequence at 200Kbp.  EcoRI site at the low base position.
 +
 +
OLIGO            start  len      tm    gc%  any    3' seq
 +
LEFT PRIMER        16  20  59.94  45.00  3.00  1.00 TTGGAACAGGTGGATGACAA
 +
RIGHT PRIMER      1042  20  60.20  50.00  4.00  2.00 TCCAATTCCTTGTCCAGCTC
 +
SEQUENCE SIZE: 2001
 +
PRODUCT SIZE: 1027, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 3.00
 +
 +
* gagagaattc TTGGAACAGGTGGATGACAA, MID-tel
 +
* gagagcggccgc TCCAATTCCTTGTCCAGCTC,  MID-chr
 +
 +
No EcoRI sites in this sequence
 +
----
----

Revision as of 22:51, 9 October 2006

Ab hac una re

10 Oct 2006

Finished sequencing pRML1 / pRML2. Tiime to go on to contstruction of the YAC. Primers for a 1000 bp sequence near the terminator.

  • Primers for the gene 399881 - 40119
OLIGO            start  len      tm     gc%   any    3' seq 
LEFT PRIMER        132   20   59.41   40.00  8.00  0.00 TGAATGCCGGGATTAGTTTT
RIGHT PRIMER      1110   20   60.92   50.00  5.00  0.00 TCCAGGACTTGGTGGTTTTG  (terminator is at the 5' end of this)
SEQUENCE SIZE: 1398
INCLUDED REGION SIZE: 1398
PRODUCT SIZE: 979, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 0.00

EcoRI site goes next to the terminator, NotI site goes away from terminator

  • gagagagaattc TCCAGGACTTGGTGGTTTTG, RH-tel
  • gagagcggccgc TGAATGCCGGGATTAGTTTT, RH-chr

EcoRI does not cut this sequence


  • Primers for the gene 401278-404xxx (Chitinase)
OLIGO            start  len      tm     gc%   any    3' seq 
LEFT PRIMER         72   20   59.00   40.00  4.00  2.00 TTTTTGGTTCTGTTCCACCA  (terminator is at the 5' end of this)
RIGHT PRIMER       976   22   58.67   31.82  6.00  3.00 TGATTGAGGAGGAAATTTTGAA
SEQUENCE SIZE: 1123
INCLUDED REGION SIZE: 1123
PRODUCT SIZE: 905, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 1.00
  • gagagaattc TTTTTGGTTCTGTTCCACCA, LH-tel
  • gagagcggccgc TGAATGCCGGGATTAGTTTT, LH-chr

EcoRI does not cut this sequence.


Sequence at 200Kbp. EcoRI site at the low base position.

OLIGO            start  len      tm     gc%   any    3' seq 
LEFT PRIMER         16   20   59.94   45.00  3.00  1.00 TTGGAACAGGTGGATGACAA
RIGHT PRIMER      1042   20   60.20   50.00  4.00  2.00 TCCAATTCCTTGTCCAGCTC
SEQUENCE SIZE: 2001
PRODUCT SIZE: 1027, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 3.00
  • gagagaattc TTGGAACAGGTGGATGACAA, MID-tel
  • gagagcggccgc TCCAATTCCTTGTCCAGCTC, MID-chr

No EcoRI sites in this sequence



9 September 2006

primers for further sequencing of pRML1/2

primers for aacC1 coding region, formation of the promoter sequence

finish ligation tests

page for Lim

Knight:Part construction plans



3 September 2006

yebU also is a close relative of AAT75553. Andersen06. E-25 match.



2 September 2006

Established role of protein AAT75660, previously unknown function, now clearly yggJ or rsmE (Basturea06, PMID: 16431987). Methyltransferase modifying the 16S base at location U1498. E value match 2E-16 with the E. coli gene.

No evidence for tusBDC complex in MF.

ksgA (rsmA), another 16S ribosomal RNA modifying protein is AAT75361. VanBuul85

rsmB is AAT75553 (5-methyl cytosine transferase for tRNA and rRNA) Tscherne99

rsmC appears to be missing.



1 September 2006

design and order fluorescent primers for debugging construction plasmid PCR, cutting and ligation. Pacific blue and Alexa Fluor 488 appear to work well with UV excitation. Prefix-R and Suffix-F ordered.

Miniprep of pRML1, pRML2, pYAC4. Design and order sequencing primers and half of the needed construction primers for YAC left and right arms. Remainder awaiting sequencing results.



29 August 2006


Order medium components (Spencer 93)

Sequencing primers for pRML1, pRML2

  • pBluescript II SK+
  • pCGS966
  • URA3
  • TRP
  • ARS1
  • ARSH4
  • CEN4

Construct parts from Left, Right telomere, Left, Right chromosome ends

Construct parts from 1000 bp sequences at MF terminator


17 August 2006


Wood's Hole ISAT TCDB transporter database. Useful in characterizing and searching for transporter protein properties and motifs.


Demo of "cool stuff" minty fresh E. coli and banana smelling E. coli. Discussions with Carl Landweber and Bob Colwell especially imporant. Possible teaming on energy production with SRI / Sandia.


12 August 2006


Sci Foo camp. Jonathan Eisen discussions. Dyson / Danny / Brand


10 August 2006


Peter Karp. Discussons on SRI EcoCyc/Biocyc uses for Mesoplasma florum design and editing.


9 August 2006


Rocha paper on survey of recombination systems in sequenced bacteria. Florum has RecO, RecR, but not RecF in the RecFOR system. RecA present. RecD present. RuvAB present, ruvC not, but replaced with RecU. yqgF gene part of the recomination system. PriA missing. RecBC missing, RecD form is different from the form found in organisms with RecBC also.


Received yeast strains and plasmids from Weiss lab. Confirmed that they cannot PCR through the centromere CDS II region.


Codon usage of the P1014 cassette. CTC codon (Lys) is rare and used 4+ times. CGG is not present in the CDS. Three GATC sequences.


7 August 2006


SMC proteins maintain chromosome condensation. Co-factors scpA and scpB. Me. florum proteins are AAT7589, AAT75908, AAT75907 respectively. B. subtilis homologs: P51834, P35154, P35155. Volkov03. Notarnicola91 reports SMC protein in M. hyorhinis (P115).


Compromise codon usage: multiply codon probabilities for corresponding codons from each organism, then take the square root (geometric mean). Renormalize within each amino acid to establish new relative probabilities.


Personal tools