Tk:Ab hac una re - Revision history

Tk: /* Ab hac una re */

Tk — Sun, 18 Nov 2007 03:42:46 GMT

Ab hac una re

←Older revision		Revision as of 03:42, 18 November 2007
Line 5:		Line 5:

	Found a match in AAT76025, possible match in AAT75382.		Found a match in AAT76025, possible match in AAT75382.
		+
		+	SLA-2 motif Rosati99, IGVDxDQ
		+

Tk — Sun, 18 Nov 2007 03:33:13 GMT

←Older revision		Revision as of 03:33, 18 November 2007
Line 1:		Line 1:
	===Ab hac una re===		===Ab hac una re===
		+	17 Nov 2007
		+
		+	SLA sites in MF genome. Calcutt99a shows motif for an unknown protein site in lipoproteins, concensus sequence TDXGXXDDKSFNQSAWE.
		+
		+	Found a match in AAT76025, possible match in AAT75382.
		+
		+
	3 June 2007		3 June 2007

Tk — Mon, 04 Jun 2007 00:21:04 GMT

Ab hac una re

Tk — Sun, 03 Jun 2007 21:08:17 GMT

Ab hac una re

←Older revision		Revision as of 21:08, 3 June 2007
Line 1:		Line 1:
	===Ab hac una re===		===Ab hac una re===
		+	3 June 2007
		+
		+	N15 cloning vectors, plasmids:
		+	* AF064539
		+	* EF583812 pJAZZ-OC. Copies 24802 (telomere site) - 35005 [MCS, resistance] 23696 - 24802 (telomere site)
		+	* DQ391279
		+
		+
	22 Nov 2006		22 Nov 2006

Tk — Thu, 23 Nov 2006 05:24:07 GMT

Ab hac una re

←Older revision		Revision as of 05:24, 23 November 2006
Line 7:		Line 7:
	* 400990-400038 fragment from MF		* 400990-400038 fragment from MF
	* potential mutation in MF sequence at TATTTTCTTCTc/tTTTTCAT c sequenced in the plasmid; t present in genome sequence.		* potential mutation in MF sequence at TATTTTCTTCTc/tTTTTCAT c sequenced in the plasmid; t present in genome sequence.
		+	* coordinates of MF genome region is 400012-400990 (RH); gap 400991-401348; 401349-402253 (LH)
		+

	17 Oct 2006		17 Oct 2006

Tk — Wed, 22 Nov 2006 21:55:27 GMT

Ab hac una re

←Older revision		Revision as of 21:55, 22 November 2006
Line 1:		Line 1:
	===Ab hac una re===		===Ab hac una re===
		+	22 Nov 2006
		+
		+	* pRML1-L plasmid constructed.
		+	* 401349-402237 fragment from MF
		+	* pRML2-R plasmid constructed.
		+	* 400990-400038 fragment from MF
		+	* potential mutation in MF sequence at TATTTTCTTCTc/tTTTTCAT c sequenced in the plasmid; t present in genome sequence.

	17 Oct 2006		17 Oct 2006

Tk — Thu, 19 Oct 2006 04:49:11 GMT

Ab hac una re

←Older revision		Revision as of 04:49, 19 October 2006
Line 1:		Line 1:
	===Ab hac una re===		===Ab hac una re===
		+
	17 Oct 2006		17 Oct 2006

	Errors in the primers:		Errors in the primers:
-	~~LH-Chr primer was wrong. Correct is:~~
-	* gcgagtgcggccgc TGATTGAGGAGGAAATTTTGAA, LH-chr
-	* tagactgcggccgc TCCAATTCCTTGTCCAGCTC, MID-chr

		+	* gcgagtgcggccgc TGATTGAGGAGGAAATTTTGAA, LH-chr2
		+	** LH-Chr primer was wrong. Misprimes at another chromosome location, but no easy change.
		+	* tagactgcggccgc TCCAATTCCTTGTCCAGCTC, MID-chr2
		+	** MID-chr primer had strong primer-dimer due to gaga extension.
		+	* gagagaattc TTTTTGGTTCTGTTCCACCAT, LH-tel2
		+	** LH-tel had mispriming potential at alternative site in chromosome.

Tk — Thu, 19 Oct 2006 04:03:47 GMT

Ab hac una re

←Older revision		Revision as of 04:03, 19 October 2006
Line 1:		Line 1:
	===Ab hac una re===		===Ab hac una re===
		+	17 Oct 2006
		+
		+	Errors in the primers:
		+	LH-Chr primer was wrong. Correct is:
		+	* gcgagtgcggccgc TGATTGAGGAGGAAATTTTGAA, LH-chr
		+	* tagactgcggccgc TCCAATTCCTTGTCCAGCTC, MID-chr
		+
		+
		+
	10 Oct 2006		10 Oct 2006

Tk — Tue, 10 Oct 2006 02:51:06 GMT

←Older revision		Revision as of 02:51, 10 October 2006
Line 34:		Line 34:

	EcoRI does not cut this sequence.		EcoRI does not cut this sequence.
		+
		+
		+	Sequence at 200Kbp. EcoRI site at the low base position.
		+
		+	OLIGO start len tm gc% any 3' seq
		+	LEFT PRIMER 16 20 59.94 45.00 3.00 1.00 TTGGAACAGGTGGATGACAA
		+	RIGHT PRIMER 1042 20 60.20 50.00 4.00 2.00 TCCAATTCCTTGTCCAGCTC
		+	SEQUENCE SIZE: 2001
		+	PRODUCT SIZE: 1027, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 3.00
		+
		+	* gagagaattc TTGGAACAGGTGGATGACAA, MID-tel
		+	* gagagcggccgc TCCAATTCCTTGTCCAGCTC, MID-chr
		+
		+	No EcoRI sites in this sequence
		+

	----		----

Tk — Tue, 10 Oct 2006 02:42:37 GMT

Ab hac una re

←Older revision		Revision as of 02:42, 10 October 2006
Line 1:		Line 1:
	===Ab hac una re===		===Ab hac una re===
		+	10 Oct 2006
		+
		+	Finished sequencing pRML1 / pRML2. Tiime to go on to contstruction of the YAC. Primers for a 1000 bp sequence near the terminator.
		+
		+	* Primers for the gene 399881 - 40119
		+
		+	OLIGO start len tm gc% any 3' seq
		+	LEFT PRIMER 132 20 59.41 40.00 8.00 0.00 TGAATGCCGGGATTAGTTTT
		+	RIGHT PRIMER 1110 20 60.92 50.00 5.00 0.00 TCCAGGACTTGGTGGTTTTG (terminator is at the 5' end of this)
		+	SEQUENCE SIZE: 1398
		+	INCLUDED REGION SIZE: 1398
		+	PRODUCT SIZE: 979, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 0.00
		+
		+	EcoRI site goes next to the terminator, NotI site goes away from terminator
		+
		+	* gagagagaattc TCCAGGACTTGGTGGTTTTG, RH-tel
		+	* gagagcggccgc TGAATGCCGGGATTAGTTTT, RH-chr
		+
		+	EcoRI does not cut this sequence
		+
		+
		+
		+	* Primers for the gene 401278-404xxx (Chitinase)
		+	OLIGO start len tm gc% any 3' seq
		+	LEFT PRIMER 72 20 59.00 40.00 4.00 2.00 TTTTTGGTTCTGTTCCACCA (terminator is at the 5' end of this)
		+	RIGHT PRIMER 976 22 58.67 31.82 6.00 3.00 TGATTGAGGAGGAAATTTTGAA
		+	SEQUENCE SIZE: 1123
		+	INCLUDED REGION SIZE: 1123
		+	PRODUCT SIZE: 905, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 1.00
		+
		+	* gagagaattc TTTTTGGTTCTGTTCCACCA, LH-tel
		+	* gagagcggccgc TGAATGCCGGGATTAGTTTT, LH-chr
		+
		+	EcoRI does not cut this sequence.
		+
		+	----
	9 September 2006		9 September 2006