User:Adriana De Castro/Notebook/Biology 210 at AU

15 January 2016 Observing Evolution Lab #1 Transect #3 is near bender arena. The ground was covered with many short dried plants mostly. There were about 8 trees that still have green leaves. Also, there were medium sized bushes that were completely dried. It had no water in it but had many dried leaves and wet soil. We collected in a plastic bag soil and leaves for the hay infusion. It had biotic factors such as leaves and trees but also had abiotic factors such as rocks.

28 January 2015 Microorganisms in my Hay Infusion I. Introduction: In this experiment we are going to observe samples of our hay infusion to identify protist found in that ecosystem. We want to observe their characteristics and try to differentiate algae and protist by using a Dichotomous Key to identify the exact organism. II. Methods and Materials: In this experiment we made a wet mount of organisms we already knew about and then used the Dichotomous Key to determine that organisms identity that was know to practice and learn how to use the Dichotomous Key. As a group we then took our Hay Infusion and made three wet mounts one from the top niche, one from the middle niche, and one from the bottom niche. After we observed them on the microscope and identified one organism from each niche in the hay infusion. Later we prepared the serial dilutions that are going to be observed in the next lab. We labeled four tubes of 10mLs sterile broth 10-2, 10-4, 10-6, 10-8. We took eight plates four with nutrient agar and four nutrient agar plus tetracycline and we labeled one plate from each group with 10-3, 10-5, 10-7, 10-9. We pipetted 100micro/liters from the Hay Infusion to the 10mLs of sterile broth into the tube labeled10-2. Another 100micro/liters of broth were taken from tube 10-2 and were passed to the tube labeled 10-4 and the same procedure was done to make the 10-6 and 10-8 serial dilutions. To create the serial dilutions on the plate we pipetted 100micro/liters from the 10-2 tube and placed them in the agora plate labeled 10-3 and was spread. The exact procedure was made for the three remaining plates. The 100micro/liters from the 10-4 tube were placed on the plate labeled 10-5, the 10-6 100micro/liters were placed in the plate labeled 10-7 and the same amount also was taken from 10-8 and placed on the 10-9 plates. These serial dilutions were left in the rack for one week to develop. III. Results: The Hay Infusion culture smelled like pool water however it had like mold in the surface. From the three different niches we took a sample from we found different organism. According to the Dichotomous Key we found in the top niche we found a Blepharisma . This paramecium had a light pink coloring inside and measured about 206micro/liters. In the middle niche we found an Euglena that had a long shape with green coloring and measured about 37micro/liters. In the bottom niche we believed we found a Paramecium bursaria. This paramecium had a rounded shape and was very motile, crawling under the dirt seen in the slide. The serial dilution made for the agora plates was left incubating and the results if any will be seen next week. IV. Data and Observations: Serial Dilution

Hay Infusion

Hay Infusion

Euglena

Lab notes drawings about organisms we saw in the top and last level and we couldn’t take pictures off.

3 February 2016 Lab III: Process of Identification of Bacteria I. Introduction In this experiment we are trying to observe the diversity of bacteria in our transect from the samples of our hay infusion that were place in agora plates. Nonetheless, we want to identify which specific bacteria are in there-by-their features such as: colony morphology, shape, motility and gran stain. Also we want to test their resistance to the antibiotic tetracycline since samples of the hay infusion were placed in agora plates with tetracycline. II. Materials and Methods To quantify and observe these microorganisms and all of their features we observed the agora plates that were left cultivating last week and counted the number of colonies on each plate. Evidently to know how many colonies were present on a plate we counted them, but to know the number of colonies per millimeter each agora plate had a different conversion factor that mas multiplied by the number of colonies on a plate, conversely the conversion factor was the same regardless if the plate had the presence of tetracycline. Agora plates labeled10-3 have a conversion factor of x103, plates10-5 have a conversion factor of x105, plates 10-7 have a conversion factor of x107 and plates 10-9 have a conversion factor of x109. To test the resistance of the bacteria’s to tetracycline we observed the number of colonies on each plate with and without tetracycline and compared the results. The cell shapes and the motility of these organisms needs to be observed under a microscope, for this reason we did a wet mount for four plates two with tetracycline and two without tetracycline; we chose 10-3T, 10-5T, 10-5, and 10-7. To do the wet mount procedure we sterilized a loop over flame and scrape up a small sample from the plate and mixed it with a drop of water on a slide and placed a cover slip over the mixture. This was done four times. Because it is hard to observe bacteria in the microscope we did the gram stain procedure. We took the wet mount slides that were prepared and took off the cover slip and covered the bacterial smear with crystal violet for 1 minute and rinsed it with water. Covered the bacterial stains with Gram’s iodine mordant for 1 minute and once again was rinsed with water. The slides were decolorized with 95% alcohol for 10-20 seconds. We covered the slip with safranin stain for 20-30 seconds and rinsed it off with water. The excess was cleaned with a Kim wipe and were observed under 40x and focused on the gram stain. Later to amplify the 16S rRNA gene a PCR reaction was set. We choose one sample with tetracycline (10-3T) and one without it (10-5). We labeled the 2 PCR tubes and added 20µl of primer/water mixture to each. With a toothpick we took a small sample of bacteria and placed it inside each indicated tube a different toothpick was used for the two samples after each tube was mixed to dissolve the PCR bead and was placed in the PCR machine. Next week the PCR products will be run on agarose gel. III. Results The results of the colonies on each plate varied greatly. The plates that had the presence of the antibiotic tetracycline had less number of colonies or none compared to those that had no tetracycline, the difference can be observed in Table #1 and Figures 1 through 4 demonstrate how the plates looked. Nonetheless, the plates with tetracycline that had bacteria on them must have been insensitive to antibiotics or were resistant to antibiotics. The cells observed and their details are described in Table #2. Figure 5 shows the cells observed on the 10-5T wet mount slide. Figure 6 shows the cells observed on 10-3T wet mount slide. Figure 7 shows the cells on the 10-5 wet mount slide and Figure 8 shows the ones observed on the wet mount slide 10-7. After the gram stain procedure was done and the slides were observed they were described in Table #2. Figure 9 shows the cells observed on the 10-3T Gram Stain slide. Figure 10 shows cells on the 10-5T Gram Stain slide. Figure 11 shows cells on the 10-5 on the Gram Stain slide and Figure 12 shows cells on the 10-7 Gram Stain Slide.

IV. Table and Graphs

12 February 2016 Lab IV: Autotrophs are needed in Ecosystems I. Introduction In this experiment we are trying to identify different types of plants from a specific transect. Nonetheless, we want to know how plants differ from each other and especially from fungi. Because there is a difference we want to characterize both and compare them. Additionally we want to compare and contrast angiosperms and bryophytes and point out the important parts that form each one. II. Methods and Materials To accomplish our goals in this experiment we visited our transect and collected two Ziploc bags and filled each one with 500g. One was filled with leaf litter that is going to be used for the Berlese funnel and the other one was filled with different plant samples. Those plant samples were described in size, shape, vascularization, specialized structures and mechanisms of reproduction. Once that was done bryophytes and angiosperms vascularization system were observed in the dissecting microscopes and then compared. Additionally we observed in the dissecting microscope the cross-section of an angiosperm, lily. We took the leaves from our transect, observed them and then identified if there were monocot or dicot and if there was evidence of flowers or spores. We took the fungi and examined them and had to identify to what group the belonged and identify the sporangia. Lastly the Berlese Funnel was set by pouring 25mL of the 50:50 ethanol solution in the 50mL conical tube. A fitted piece of the screening material was taped to the bottom of the funnel. We placed the leaf litter in the top of the funnel and placed the funnel on a ring stand so that it was held into the tube with the ethanol. The base of the funnel was “parafilmed” to prevent the ethanol from evaporating. A 40-watt lamp was placed above the funnel 1-2 inches away from the leaf litter and everything was covered with foil paper and left it there to be observed in a week. III. Results The amplification of the 16S rRNA gene was not achievable since there was not enough sample to run the PCR. However, some other samples were proficient enough to be run in the PCR and the results can be seen in Figure 1. However, the 5 plants from the transect (Figure 2.) which are seen in Figures 3, were described and the data is seen in Table 1. Obviously, after observing the moss we concluded that it has no vascularization and the height of the plant is really short on the contrary the height of the lily is much taller. After the precise observation of the fungi we could observe the sporangia that is were the spores are formed and is the way for them to reproduce. In Figure 4 you can observe the sporangia, which are the black dots, and we could identify that specific fungus belongs to the Zygomicota. Finally the results of the Berlese funnel observed in Figure 5, will be seen in the next class a week from today.

IV. Tables and Graphs

Lab V: 19/ feb/ 2016

I. Introduction In this experiment we learn about invertebrates and vertebrates. The objective is to learn how to use a dichotomous key to identify the animals found in the Berlese Funnel. Also, we plan to learn about the difference in motility mechanisms in flatworms, annelids, and roundworms and to be able to identify what are an acoelomate, a pseudocoleomate and coelomates. Nonetheless, we aim to understand how different animals have different symmetries and to be able to identify them. II. Methods and Materials In the process of identifying acoelomates, pseudocoelomates, and coelomates and differentiating their different movements we observed through a dissecting microscope: acoelomate Planaria, pseudocoelomate nematodes, and coelomate Annelida. To be able to identify the arthropods we had to identify with a dichotomous key the organisms from the classes: arachnidan, diplopods, chilopoda, insect, and crustacean. Later to analyze the invertebrates from our Berlese Funnel we broke down the Berlese Funnel and pour the top 10-15mL of 50% ethanol into a petri dish. The remaining liquid was poured into a second petri dish. After, both petri dishes were examined with the dissecting microscope and the invertebrates were identified with a dichotomous key. To finalize we had to analyze our transect and what we found in it and conclude what we think might be other animals that live there. III. Results The results of our experiment were not as varied as we expected. We had to identify five invertebrates. However, we could only identify two different organisms from our Berlese Funnel, we found six of the same organisms called springtails. The other organism was one flea. A reason for the lack of variety might be because our funnel size was very small or because our transect was very limited. Since we could only identify two different invertebrates Table 1 gives a more detailed description of what was found and Figures 1-3 show the organisms. Observing our transect and the organisms found we could say that other organisms that live there are birds, butterflies, and different types of worms. All of these organisms represent a community, that even though they have different characteristics they all contribute to help each other survive. IV. Data and Observations Table 1. Organisms in the Berlese Funnel Organism (phylum and class) Length in mm Number in sample Description of Organism Siphonaptera, Arthropoda, Insecta 8mm 1 Oval/ round compressed body, short legs modified for jumping. Collembola, Arthropoda, Entognatha 10mm-15mm 6 Wingless, body not compressed, with a “tail” used for jumping and has antenas.

Figure 1.

Figure 2.

Figure 3.

Sequencing Transect 3:

Sample A: MB66 NNNNNNNNNNNNNNNNNANANTGNANNCCNNAGCGGTAGCAGANGNTATCANGATGTCCGACAGCGGCTTGCNGATGAGG TACAAGTGTGGTTTATGCCTTTAGCCGGGGGAGGCACTTTCGTTGGGAAGATTACAACCCCATAATTATAATCGTGGCAT CTCTTGAAANGGACTGGTCCAGTGGAAAAAGAAGGGCCCGACCCTGATGANGCAGTTGGTACGGGGACGGTTCACCANGG CTGTGATGTTTGTGGGGCCTGANAGGGTGATCCCCCTGTGTGGTACGGAGACATTGACCCAACACCAATTGCAGGCGCCT CTGAGGAATATTGGACAATGGGTGAGAGCCTGATCNNNANTCNNCGNGAAGGATGACGGTGCTCCTGGTTGTATTCTTCT TTTGTATATTGATGGTGATTTCCTCGTGGGTGAAGCTGAATGAACTATACAAGCAGNAACCGGNGAGGCCCNTGCCTTCA GCCTCGGTNNTACNCAGGGTGTTGCCGTTTGAGAGATTTATTGNNTTNTCGAGGTTGGTTCNNGCNGANGGCNNACAATA TGCTGTANNNNTNACTNNNNGGTCAATCTGCATANGTTGGCGCGNGNCGCGACTNTTGGATATCTACCTTGCNTAAAANA NTCNNACANGGAANNCNTANATAATANCNNNNNCACCAATTGCGAANGCAGGTTACTATGTCTTAACTGACGCTGATGGA CGAAAGCGTGGGGAGCGAACAGGATTANATACCCTGGTANTCCACGCCNTNNNNNATGCTNACTCGTTTTTGGGNTCTTC NGATTCAGAGACTAAACNAAAGTGATAAGTTAGCCACCTGGGGAGTACGTTCNCAAGANTGAAACTCNAAGGAATTGACN GNNCCCGCACAANCGGNGGATTATGTGNNTTNATTCNATGATACGCNANGAANCCTTNNCCNANGCTTAANTGGGNANTN GATCGGTTTNNNANNNNACCTTNCCTTNNNCAATTTCAAGGTNCTGCATGGNTNGTCNNCNGCTNNNNCCNNNANTNNNA GNTAANTCCTGNNNNNNNGNNNCCCCNTGTCNCNNN

Sample B: MB65 NNNNNNNNNNNNNNNNNCNNNNNNTGCNGNNNNANGGNNGNCNGNNNNNNANCAATCCTGGCGGCGAGTGGCGAACGGGT GAGTAATACATCGGAACGTGCCCAATCGTGGGGGATAACGCAGCGAAAGCTGTGCTAATACCGCATACGATCTACGGATG AAAGCAGGGGATCGCAAGACCTTGCGCGAATGGAGCGGCCGATGGCAGATTAGGTAGTTGGTGAGGTAAAGGCTCACCAA GCCTTCGATCTGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAG CAGTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACT GCTTTTGTACGGAACGAAACGGCCTTTTCTAATAAAGAGGGCTAATGACGGTACCGTAAGAATAAGCACCGGCTAACTAC GTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGT AAGACAGTTGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGTGACTGCATAGCTAGAGTACGGTAGAGGGGGATGG AATTCCGCGTGTAGCANTGNAATGCGTAGATATGCGGAGGAACACCGATGGCGAANGCAATCCCCTGGACCTGTACTGAC GCTCATGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGTTGTT GGGTCTTCACTGACTCANTAACGAAGCTNACNCGTGAAGTTGACCGCCTGGGGAGTACGGCCGCAANGTTGAAACTCNAA NGAATTGACNNGGACCCGCACAAGCNGTGNATGATGTGNTTTAATTCNATGCAACGCGAAAACCTTACCCACCTTTGACA TGTACNNNANTTNNNCCAGANATGGCTTANTGCTCGAAANAAAANCGTAACNCANGTGCTNCATGNCTNNCGTCNNCNTC NTGTCGTGANA

In conclusion: Since we did not have enough sample we took the sample results from a previous section that was assigned transect #3 and put the sample in the website Blast and our results were that a bacteria found in that transect were sample A: Chryseobacterium and sample B: Vairvox.

Zebrafish Experiment: Paolas notes

Question: Will more zebrafish embryo hatch with more salinity or less salinity? In which concentration will the hatched embryo be the most normally developed?

Hypothesis: More embryos will hatch with less salinity and will be more developed than those with the most salinity.

Experiment: 24 embryos in the control group 24 embryos in experimental group

   -12 with 2ml of salt water
   -12 with 1 ml of normal water and 1 ml of salt water 

Conditions:

  - no light
  - room temperature

Zebrafish Day 1: feb 19

 Control Group: zygote
Experimental Group: zygote 

Zebrafish Day 2: feb 22 Control Group: - 14 hatched -48hrs of fertilization - 4 not hatched – 17 somites - 6 empty slots

Experimental Group: A. 2ml of salt - 10 hatched - 48hrs of fertilization - 2 not hatched

B. 1ml salt, 1ml water - 5 hatched - 48hrs of fertilization - 4 not hatched – 17 somites - 3 empty slots

Data: Day 3: Feb 24 Control alive: 17 dead: 1 empty slots: 7 Not hatched: all hatched

experimental 2ml of salt alive: 9 dead: 3 empty slots: 2 not hatched: 1

1ml of salt/ 1ml of water alive: 8 dead: 1 empty slots :4 not hatched: 0

Feb 26: Control alive: 15 dead: 2 empty slots: 7

Experimental 2ml of salt alive: 10 dead: 3 empty slots: 2

1ml of slat/ 1 ml of water: alive: 8 dead: 1 empty slots: 4

Food web and vertebrate analysis: 17/ march/ 2016 vertebrate analysis: • Even though we did not see any vertebrates in our transect because of the season we can infer vertebrates that might inhabit in our transect. • All of this vertebrates and invertebrates work together to maintain themselves and their habitat. • For example one of the birds that might inhabit our transect is the Turkey vulture o Kingdom: Animalia o Phylum: Chordata o Class: Aves o Order: Cathartiformes o Family: Cathartidae o Genus:Cathartes o Species: C. aura

food web: • The food web represents where these organisms that we found in our transect get their energy from. The plants get their energy from the sun, these plants include algae, moss, flowers, and leaves. Fungi can get their energy from plants and organic matter. Bacteria also get their energy from organic matter. Plant-like protists get their energy from the sunlight, , and finally, arthropods get their energy source from fungi, bacteria and plant-like protists. • The other animals that are mentioned in our food web are hypothesized. We inferred that if these organisms exist in our transect, their predators must too be around. We looked up the predators of the organisms we found and made a more extensive food web. We infer a lot of these animals are present in our transect or are close to our transect, even if we did not see them. • There is a high probability that birds, snails, squirrels, spiders, beetles, rabbits, rats, salamanders, and frogs exist in our transect. These animals may not have been present at the particular moment we went to collect samples in our transect; however, these animals have been seen around campus therefore there is a chance that they might be present in our transect. • Deers, skunks, and racoons are bigger vertebrates that are not frequently seen around campus, however, they can also be present. The probability of them being present is lower than the previous mentioned organisms.