User:Alji: Difference between revisions
(13 intermediate revisions by the same user not shown) | |||
Line 38: | Line 38: | ||
==== M13 Refactoring ==== | ==== M13 Refactoring ==== | ||
I attempted to refactor the M13K07 phage by removing the overlapping areas of genes between the HpaI site of gene 2 and the BamHI site of gene 3. I did this by duplicating each gene (promoter, rbs, and ORF) and placing it after the ORF of the previous gene. I mutated the RBS's of each overlapping area to a silent mutation to prevent readout of the overlapping sections. There were 6 places of overlap, and I have included what changes I made. As a result, I have added 769 bp to the original section of DNA. In between each gene, I left 11 extra base pairs in order to introduce restriction sites so that each part can be manipulated individually. I want to see what others have done before attempting to introduce new restriction endonuclease sites. | |||
{| Border="1" | {| Border="1" | ||
! Overlapping Areas !! Modified sequence | ! Overlapping Areas !! Original Sequence !! Modified sequence | ||
|- | |- | ||
| Gene 2 ORF and Gene 10 RBS || | | Gene 2 ORF and Gene 10 RBS || At bp 478: gcatttgag || gcGtttgag | ||
|- | |- | ||
| Gene | | Gene 2 ORF and Gene 5 RBS || At bp 826: gcataaggt || gcGtaaggt | ||
|- | |- | ||
| Gene | | Gene 10 ORF and Gene 5 RBS || At bp 1286: gcataaggt || gcGtaaggt | ||
|- | |- | ||
| Gene 5 ORF and Gene | | Gene 5 ORF and Gene 7 RBS || At bp 1609: gttccggct || gtCccggct | ||
|- | |- | ||
| Gene 9 ORF and Gene 8 RBS || || | | Gene 7 ORF and Gene 9 RBS || At bp 1733: cgctggggg || cgAtggggg | ||
|- | |||
| Gene 9 ORF and Gene 8 RBS || At bp 1869: aatggaaac || aaCggaaac | |||
|} | |||
The refactored genome is [http://parts.mit.edu/registry/index.php/Part:BBa_M31332 Part BBa_M31332] on the Registry of Standard Biological Parts | |||
====SAGA subunits, <i> S. cerevisiae </i>==== | |||
{| border="1" | |||
! Ada subunits | |||
! size,chromosome,null p-type | |||
! notes | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1 Ada1] (aka HFI1, SUP110, SRM12, GAN1) | |||
| 1.467 kb/489 aa, Chr. XVI, <br>viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2 Ada2] (aka SWI8) | |||
| 1.305 kb/434aa, Chr. IV, <br>viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3 Ada3](aka NGG1, SWI7) | |||
| 2.109 kb/702aa, Chr. IV, <br>viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5 Gcn5] (aka ADA4, SWI9) | |||
| 1.32 kb/439aa, Chr. VII, <br>viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5 Ada5] (aka SPT20) | |||
| 1.815 kb/604aa, Chr. XV, <br>viable | |||
| | |||
|} | |||
{| border="1" | |||
! Spt subunits | |||
! size, chromosome, null p-type | |||
! notes | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3 Spt3] | |||
| 1.014 kb/337aa, Chr. IV, <br> viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7 Spt7](aka GIT2) | |||
| 3.999 kb/1332aa, Chr. II, <br> viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8 Spt8] | |||
| 1.809 kb/602aa, Chr. XII, <br> viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20 Spt20] (aka Ada5) | |||
| 1.815 kb/604aa, Chr. XV, <br> viable | |||
| | |||
|} | |||
{| border="1" | |||
! TAF subunits | |||
! size, chromosome, null p-type | |||
! notes | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF5 TAF5] (aka TAF90) | |||
| 2.397 kb/798aa, Chr. II, <font color = red>inviable</font color> | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF6 TAF6] (aka TAF60) | |||
| 1.551 kb/516aa, Chr. VII, <font color = red>inviable</font color> | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF9 TAF9] (aka TAF17) | |||
| 0.474 kb/157aa, Chr. XIII, <font color = red>inviable</font color> | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF10 TAF10] (aka TAF23, TAF25) | |||
| 0.621 kb/206aa, Chr. IV, <font color = red>inviable</font color> | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF12 TAF12](aka TAF61, TAF68) | |||
| 1.620 kb/539aa, Chr. IV, <font color = red>inviable</font color> | |||
| | |||
|} | |||
{| border="1" | |||
! Tra1 subunit | |||
! size, chromosome, null p-type | |||
! notes | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TRA1 Tra1] | |||
| 11.235 kb/3744aa, Chr. VIII, <font color = red>inviable</font color> | |||
| | |||
|} | |||
{| border="1" | |||
! other subunits | |||
! size, chromosome, null p-type | |||
! notes | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73 Sgf73] | |||
| 1.974 kb/657aa, Chr. VII , <br> viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29 Sgf29] | |||
| 0.779 kb/259aa, Chr. III, <br> viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11 Sgf11] | |||
| 0.3 kb/99aa, Chr.XVI, <br> viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8 Ubp8] | |||
| 1.416 kb/471aa, Chr. XIII, <br> viable | |||
| | |||
|- | |||
| [http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Sus1 Sus1] | |||
| gene with intron, Chr. II, <br> viable | |||
| | |||
|} | |||
{| border="1" | |||
! Primer | |||
! Primer Number | |||
! Sequence | |||
! Anneals | |||
|- | |||
| ''URA3'' replacement PCR Forward Primer | |||
| NO177 | |||
| 5' GCGACAAAATCAGAAGTAACAATTCTGGCCTTCACTCCAatgtcgaaagctacatataa | |||
| 20 bp upstream of ''SUS1'' | |||
|- | |||
| ''URA3'' replacement PCR Reverse Primer | |||
| NO178 | |||
| 5' TGTAATAATATTGGGAATTAAGGTGCATTTTCGTATCCTttagttttgctggccgcatc | |||
| 20 bp downstream of ''SUS1'' | |||
|- | |||
| Colony PCR Forward Primer | |||
| NO193 | |||
| 5' AATGGTTAAGATACCAATGCCGTCTACACC | |||
| 520 bp upstream of ''SUS1'' | |||
|- | |||
| Colony PCR Reverse Primer | |||
| NO179 | |||
| 5' CTGTGCCCTCCATGGAAAAATCAGTCAAGA | |||
| 191-220 bp (btm strand) after ''URA3'' ATG | |||
|} | |} | ||
{| border="1" | |||
! Media | |||
! Temperature | |||
|- | |||
| YP Galactose | |||
| 23 C | |||
|- | |||
| YP Galactose | |||
| 30 C | |||
|- | |||
| YP Galactose | |||
| 37 C | |||
|- | |||
| YP Dextrose | |||
| 23 C | |||
|- | |||
| YP Dextrose | |||
| 30 C | |||
|- | |||
| YP Dextrose | |||
| 37 C | |||
|- | |||
| YP+Rapamycin | |||
| 30 C | |||
|- | |||
| YP-Lysine | |||
| 30 C | |||
|- | |||
| YP | |||
| 30 C | |||
|- | |||
| YP-Tryptophan | |||
| 30 C | |||
|} | |||
{| border="1" | |||
! Transformation | |||
! Number of Colonies | |||
|- | |||
| "Plus template" | |||
| 10 | |||
|- | |||
| "No template" | |||
| 3 | |||
|- | |||
| 50 ng pRS406 DNA | |||
| 800 | |||
|} | |||
{| border="1" | |||
| | |||
! colspan="2" | Surface display of scFv fusion? | |||
! colspan="2" | Binding to gold? | |||
|- | |||
| | |||
! Glucose | |||
! Galactose | |||
! Glucose | |||
! Galactose | |||
|- | |||
!pCT-CON | |||
|N | |||
|Y | |||
|N | |||
|Y | |||
|- | |||
!pAu1 | |||
|N | |||
|Y | |||
|N | |||
|Y | |||
|} | |||
{| border="1" | |||
! Transformation | |||
! Number of Colonies | |||
|- | |||
| pCT-CON | |||
| 2 | |||
|- | |||
| Peptide library | |||
| 3 | |||
|- | |||
| pAu1 | |||
| 1944 | |||
|} | |||
{| border="1" | |||
! Plasmid | |||
! Altered Condition | |||
! Number of Colonies | |||
|- | |||
| pCT-CON | |||
| 45-min. panning | |||
| 0 | |||
|- | |||
| pAu1 | |||
| 45-min. panning | |||
| 0 | |||
|- | |||
| pCT-CON | |||
| 2X BSA | |||
| 0 | |||
|- | |||
| pAu1 | |||
| 2X BSA | |||
| 0 | |||
|} |
Latest revision as of 18:21, 8 May 2007
Andrew Ji
About Me
- Year: 2009
- Major: Biological Engineering
- Minor: Economics
- Email: alji AT mit DOT edu
M13K07 Genome Re-engineering ideas:
Gene | Ideas |
---|---|
I | Change size of protein to see effect of different channel sizes. |
II | Increase or decrease expression to optimize rate of + strand replication. |
III | Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host. |
IV | Change size of protein to see effect of different channel sizes. |
V | Add more DNA binding sites to see if more DNA can be packaged into phage. |
VI | Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host. |
VII | Tag protein to monitor interaction with p5/DNA complex. |
VIII | Change size of protein to experiment with the size of coat. |
IX | Tag protein to monitor interaction with p5/DNA complex. |
X | Increase expression to see if more phage leave the host E. coli. |
XI | Change size of protein to see effect of different channel sizes. |
M13 Refactoring
I attempted to refactor the M13K07 phage by removing the overlapping areas of genes between the HpaI site of gene 2 and the BamHI site of gene 3. I did this by duplicating each gene (promoter, rbs, and ORF) and placing it after the ORF of the previous gene. I mutated the RBS's of each overlapping area to a silent mutation to prevent readout of the overlapping sections. There were 6 places of overlap, and I have included what changes I made. As a result, I have added 769 bp to the original section of DNA. In between each gene, I left 11 extra base pairs in order to introduce restriction sites so that each part can be manipulated individually. I want to see what others have done before attempting to introduce new restriction endonuclease sites.
Overlapping Areas | Original Sequence | Modified sequence |
---|---|---|
Gene 2 ORF and Gene 10 RBS | At bp 478: gcatttgag | gcGtttgag |
Gene 2 ORF and Gene 5 RBS | At bp 826: gcataaggt | gcGtaaggt |
Gene 10 ORF and Gene 5 RBS | At bp 1286: gcataaggt | gcGtaaggt |
Gene 5 ORF and Gene 7 RBS | At bp 1609: gttccggct | gtCccggct |
Gene 7 ORF and Gene 9 RBS | At bp 1733: cgctggggg | cgAtggggg |
Gene 9 ORF and Gene 8 RBS | At bp 1869: aatggaaac | aaCggaaac |
The refactored genome is Part BBa_M31332 on the Registry of Standard Biological Parts
SAGA subunits, S. cerevisiae
Ada subunits | size,chromosome,null p-type | notes |
---|---|---|
Ada1 (aka HFI1, SUP110, SRM12, GAN1) | 1.467 kb/489 aa, Chr. XVI, viable |
|
Ada2 (aka SWI8) | 1.305 kb/434aa, Chr. IV, viable |
|
Ada3(aka NGG1, SWI7) | 2.109 kb/702aa, Chr. IV, viable |
|
Gcn5 (aka ADA4, SWI9) | 1.32 kb/439aa, Chr. VII, viable |
|
Ada5 (aka SPT20) | 1.815 kb/604aa, Chr. XV, viable |
Spt subunits | size, chromosome, null p-type | notes |
---|---|---|
Spt3 | 1.014 kb/337aa, Chr. IV, viable |
|
Spt7(aka GIT2) | 3.999 kb/1332aa, Chr. II, viable |
|
Spt8 | 1.809 kb/602aa, Chr. XII, viable |
|
Spt20 (aka Ada5) | 1.815 kb/604aa, Chr. XV, viable |
TAF subunits | size, chromosome, null p-type | notes |
---|---|---|
TAF5 (aka TAF90) | 2.397 kb/798aa, Chr. II, inviable | |
TAF6 (aka TAF60) | 1.551 kb/516aa, Chr. VII, inviable | |
TAF9 (aka TAF17) | 0.474 kb/157aa, Chr. XIII, inviable | |
TAF10 (aka TAF23, TAF25) | 0.621 kb/206aa, Chr. IV, inviable | |
TAF12(aka TAF61, TAF68) | 1.620 kb/539aa, Chr. IV, inviable |
Tra1 subunit | size, chromosome, null p-type | notes |
---|---|---|
Tra1 | 11.235 kb/3744aa, Chr. VIII, inviable |
other subunits | size, chromosome, null p-type | notes |
---|---|---|
Sgf73 | 1.974 kb/657aa, Chr. VII , viable |
|
Sgf29 | 0.779 kb/259aa, Chr. III, viable |
|
Sgf11 | 0.3 kb/99aa, Chr.XVI, viable |
|
Ubp8 | 1.416 kb/471aa, Chr. XIII, viable |
|
Sus1 | gene with intron, Chr. II, viable |
Primer | Primer Number | Sequence | Anneals |
---|---|---|---|
URA3 replacement PCR Forward Primer | NO177 | 5' GCGACAAAATCAGAAGTAACAATTCTGGCCTTCACTCCAatgtcgaaagctacatataa | 20 bp upstream of SUS1 |
URA3 replacement PCR Reverse Primer | NO178 | 5' TGTAATAATATTGGGAATTAAGGTGCATTTTCGTATCCTttagttttgctggccgcatc | 20 bp downstream of SUS1 |
Colony PCR Forward Primer | NO193 | 5' AATGGTTAAGATACCAATGCCGTCTACACC | 520 bp upstream of SUS1 |
Colony PCR Reverse Primer | NO179 | 5' CTGTGCCCTCCATGGAAAAATCAGTCAAGA | 191-220 bp (btm strand) after URA3 ATG |
Media | Temperature |
---|---|
YP Galactose | 23 C |
YP Galactose | 30 C |
YP Galactose | 37 C |
YP Dextrose | 23 C |
YP Dextrose | 30 C |
YP Dextrose | 37 C |
YP+Rapamycin | 30 C |
YP-Lysine | 30 C |
YP | 30 C |
YP-Tryptophan | 30 C |
Transformation | Number of Colonies |
---|---|
"Plus template" | 10 |
"No template" | 3 |
50 ng pRS406 DNA | 800 |
Surface display of scFv fusion? | Binding to gold? | |||
---|---|---|---|---|
Glucose | Galactose | Glucose | Galactose | |
pCT-CON | N | Y | N | Y |
pAu1 | N | Y | N | Y |
Transformation | Number of Colonies |
---|---|
pCT-CON | 2 |
Peptide library | 3 |
pAu1 | 1944 |
Plasmid | Altered Condition | Number of Colonies |
---|---|---|
pCT-CON | 45-min. panning | 0 |
pAu1 | 45-min. panning | 0 |
pCT-CON | 2X BSA | 0 |
pAu1 | 2X BSA | 0 |