
From OpenWetWare

Revision as of 20:21, 8 May 2007 by Alji (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search


Andrew Ji

About Me

  • Year: 2009
  • Major: Biological Engineering
  • Minor: Economics
  • Email: alji AT mit DOT edu

M13K07 Genome Re-engineering ideas:

Gene Ideas
I Change size of protein to see effect of different channel sizes.
II Increase or decrease expression to optimize rate of + strand replication.
III Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host.
IV Change size of protein to see effect of different channel sizes.
V Add more DNA binding sites to see if more DNA can be packaged into phage.
VI Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host.
VII Tag protein to monitor interaction with p5/DNA complex.
VIII Change size of protein to experiment with the size of coat.
IX Tag protein to monitor interaction with p5/DNA complex.
X Increase expression to see if more phage leave the host E. coli.
XI Change size of protein to see effect of different channel sizes.

M13 Refactoring

I attempted to refactor the M13K07 phage by removing the overlapping areas of genes between the HpaI site of gene 2 and the BamHI site of gene 3. I did this by duplicating each gene (promoter, rbs, and ORF) and placing it after the ORF of the previous gene. I mutated the RBS's of each overlapping area to a silent mutation to prevent readout of the overlapping sections. There were 6 places of overlap, and I have included what changes I made. As a result, I have added 769 bp to the original section of DNA. In between each gene, I left 11 extra base pairs in order to introduce restriction sites so that each part can be manipulated individually. I want to see what others have done before attempting to introduce new restriction endonuclease sites.

Overlapping Areas Original Sequence Modified sequence
Gene 2 ORF and Gene 10 RBS At bp 478: gcatttgag gcGtttgag
Gene 2 ORF and Gene 5 RBS At bp 826: gcataaggt gcGtaaggt
Gene 10 ORF and Gene 5 RBS At bp 1286: gcataaggt gcGtaaggt
Gene 5 ORF and Gene 7 RBS At bp 1609: gttccggct gtCccggct
Gene 7 ORF and Gene 9 RBS At bp 1733: cgctggggg cgAtggggg
Gene 9 ORF and Gene 8 RBS At bp 1869: aatggaaac aaCggaaac

The refactored genome is Part BBa_M31332 on the Registry of Standard Biological Parts

SAGA subunits, S. cerevisiae

Ada subunits size,chromosome,null p-type notes
Ada1 (aka HFI1, SUP110, SRM12, GAN1) 1.467 kb/489 aa, Chr. XVI,
Ada2 (aka SWI8) 1.305 kb/434aa, Chr. IV,
Ada3(aka NGG1, SWI7) 2.109 kb/702aa, Chr. IV,
Gcn5 (aka ADA4, SWI9) 1.32 kb/439aa, Chr. VII,
Ada5 (aka SPT20) 1.815 kb/604aa, Chr. XV,
Spt subunits size, chromosome, null p-type notes
Spt3 1.014 kb/337aa, Chr. IV,
Spt7(aka GIT2) 3.999 kb/1332aa, Chr. II,
Spt8 1.809 kb/602aa, Chr. XII,
Spt20 (aka Ada5) 1.815 kb/604aa, Chr. XV,
TAF subunits size, chromosome, null p-type notes
TAF5 (aka TAF90) 2.397 kb/798aa, Chr. II, inviable
TAF6 (aka TAF60) 1.551 kb/516aa, Chr. VII, inviable
TAF9 (aka TAF17) 0.474 kb/157aa, Chr. XIII, inviable
TAF10 (aka TAF23, TAF25) 0.621 kb/206aa, Chr. IV, inviable
TAF12(aka TAF61, TAF68) 1.620 kb/539aa, Chr. IV, inviable
Tra1 subunit size, chromosome, null p-type notes
Tra1 11.235 kb/3744aa, Chr. VIII, inviable
other subunits size, chromosome, null p-type notes
Sgf73 1.974 kb/657aa, Chr. VII ,
Sgf29 0.779 kb/259aa, Chr. III,
Sgf11 0.3 kb/99aa, Chr.XVI,
Ubp8 1.416 kb/471aa, Chr. XIII,
Sus1 gene with intron, Chr. II,

Primer Primer Number Sequence Anneals
URA3 replacement PCR Forward Primer NO177 5' GCGACAAAATCAGAAGTAACAATTCTGGCCTTCACTCCAatgtcgaaagctacatataa 20 bp upstream of SUS1
URA3 replacement PCR Reverse Primer NO178 5' TGTAATAATATTGGGAATTAAGGTGCATTTTCGTATCCTttagttttgctggccgcatc 20 bp downstream of SUS1
Colony PCR Forward Primer NO193 5' AATGGTTAAGATACCAATGCCGTCTACACC 520 bp upstream of SUS1
Colony PCR Reverse Primer NO179 5' CTGTGCCCTCCATGGAAAAATCAGTCAAGA 191-220 bp (btm strand) after URA3 ATG

Media Temperature
YP Galactose 23 C
YP Galactose 30 C
YP Galactose 37 C
YP Dextrose 23 C
YP Dextrose 30 C
YP Dextrose 37 C
YP+Rapamycin 30 C
YP-Lysine 30 C
YP 30 C
YP-Tryptophan 30 C

Transformation Number of Colonies
"Plus template" 10
"No template" 3
50 ng pRS406 DNA 800

Surface display of scFv fusion? Binding to gold?
Glucose Galactose Glucose Galactose
pAu1 N Y N Y

Transformation Number of Colonies
Peptide library 3
pAu1 1944

Plasmid Altered Condition Number of Colonies
pCT-CON 45-min. panning 0
pAu1 45-min. panning 0
pAu1 2X BSA 0
Personal tools