User:Anthony Salvagno/Notebook/Research/2011/01/14/pBSTxi Primer Designing: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 2: | Line 2: | ||
==Results== | ==Results== | ||
[https://docs.google.com/leaf?id=0Bwbdciapt4QZZDA1N2Y2NGMtMDY5YS00OWQ4LWI4YWQtMjIyNDk5YzQ5ZTA4&hl=en Sequence Fasta File]<br> | |||
Based on the results I got it looks like these primers are suitable: | Based on the results I got it looks like these primers are suitable: | ||
*Forward | *Forward | ||
Revision as of 13:38, 14 January 2011
Quick Navigation: Pages by Category | List of All Pages | Protocols
I have a 5kb vector and I want to make a 4.4kb PCR product with it. The sequence actually cloned in reverse, so we want the reverse primer to be dig labeled. I am using this site for primer design.
Results
Sequence Fasta File
Based on the results I got it looks like these primers are suitable:
- Forward
- TGTGTCGCCCTTAGGTACGAACT
- Reverse
- CTGACTCGCTGCGCTCGGTC
That makes the product 4.4kb and will yield a small fragment after digestion that can be removed via PCR cleanup (less than 100bp).
