User:Barry Canton/Notebook/T7 RNAP transcription of rRNA/2008/07/02: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
Line 29: Line 29:
*5'-GTT GGA TCA TTG TGG TTA-3' 47 - ordered this
*5'-GTT GGA TCA TTG TGG TTA-3' 47 - ordered this
*reverse complement - TAACCACAATGATCCAAC
*reverse complement - TAACCACAATGATCCAAC
 
*reverse complement - TACCACAATGATCCAAC - ordered this
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
|}
|}


__NOTOC__
__NOTOC__

Latest revision as of 10:40, 10 July 2008

<html><img src="/images/c/c3/Resultset_previous.png" border="0"/></html>Previous entry T7 RNAP transcription of rRNA Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>
  • Obtain detection substrate from Bryan
  • Order chemifluorescent detection substrate.
  • Research in vitro transcription to design better standards.

Primer design information

>wt AGGGGAACCTGCGGTTGGATCACCTCCTTA

>mutant AGGGGAACCTGCGGTTGGATCATTGTGGTA

wt16sProbe1

  • 5'-GGT TGG ATC ACC TCC-3' 49

wt16sProbe2

  • 5'-GTT GGA TCA CCT CCT TA-3' 48
  • reverse complement - TAAGGAGGTGATCCAAC

o16sProbe1

  • 5'-GTT GGA TCA TTG TGG-3' 44

o16sProbe2

  • 5'-GTT GGA TCA TTG TGG TTA-3' 47 - ordered this
  • reverse complement - TAACCACAATGATCCAAC
  • reverse complement - TACCACAATGATCCAAC - ordered this


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Barry_Canton/Notebook/T7_RNAP_transcription_of_rRNA/2008/07/02&oldid=219942"