User:Benji Moncivaiz: Difference between revisions
No edit summary |
|||
(9 intermediate revisions by the same user not shown) | |||
Line 9: | Line 9: | ||
*[[Special:Emailuser/Benji Moncivaiz|Email me through OpenWetWare]] | *[[Special:Emailuser/Benji Moncivaiz|Email me through OpenWetWare]] | ||
==Mod2== | |||
Day1: Protein Engineering with PCR assignment | |||
Forward primer: | |||
FLAP landing sequence | |||
5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’ | |||
Reverse Primer: | |||
FLAP landing sequence | |||
5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’ | |||
==Education== | ==Education== | ||
Line 43: | Line 54: | ||
Benji | Benji | ||
===Course/Minor=== | ===Course/Minor=== | ||
2/(20&4) | 2 / (20&4) | ||
===Year of Graduation=== | ===Year of Graduation=== | ||
2011 | 2011 | ||
Line 52: | Line 64: | ||
===Have you taken or are you taking...=== | ===Have you taken or are you taking...=== | ||
7.05/5.07 (Biochemistry)<br> | 7.05/5.07 (Biochemistry) Not yet. <br> | ||
7.06 (Cell Biology)<br> | 7.06 (Cell Biology) No. <br> | ||
7.02 (General Biology Lab)<br> | 7.02 (General Biology Lab) Nope. <br> | ||
5.310 (General Chemistry Lab)<br> | 5.310 (General Chemistry Lab) Definitely not :) <br> | ||
Do you have any experience culturing cells (mammalian, yeast or microbial)?<br> No | Do you have any experience culturing cells (mammalian, yeast or microbial)?<br> No | ||
Line 62: | Line 74: | ||
===Please briefly describe any previous laboratory experience=== | ===Please briefly describe any previous laboratory experience=== | ||
I worked in a lab with HST. I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO. I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them. I did not get to work with any of the cells (staining, passaging) or | I worked in a lab with HST. I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO. I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them. I did not get to work with any of the cells (staining, passaging) or do any work under the hood, but I got to do a lot of work leading up to that and making it possible! | ||
===Anything else you would like us to know?=== | ===Anything else you would like us to know?=== | ||
I am basically a clean slate, as you can tell, and I am excited to get my hands on some good biology! | |||
==Useful links== | ==Useful links== | ||
*[[OpenWetWare:Welcome|Introductory tutorial]] | *[[OpenWetWare:Welcome|Introductory tutorial]] | ||
*[[Help|OpenWetWare help pages]] | *[[Help|OpenWetWare help pages]] |
Latest revision as of 19:26, 6 November 2010
Contact Info
- Benji Moncivaiz
- MIT
- Address 1
- Address 2
- City, State, Country etc.
- Email me through OpenWetWare
Mod2
Day1: Protein Engineering with PCR assignment
Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’
Education
- Year, PhD, Institute
- Year, MS, Institute
- Year, BS, Institute
Research interests
- Interest 1
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
- JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
leave a comment about a paper here
- ISBN:0879697164
Please copy the source code from this page to your user page, fill in the answers and print out a copy for next time.
You do not need to keep the information on your user page once you've printed it out.
Registration/Questionnaire: 20.109 Fall 2008
Last Name
Moncivaiz II
First Name
Benjamin
Preferred name
Benji
Course/Minor
2 / (20&4)
Year of Graduation
2011
Telephone #
benmonci AT mit DOT edu
Have you taken or are you taking...
7.05/5.07 (Biochemistry) Not yet.
7.06 (Cell Biology) No.
7.02 (General Biology Lab) Nope.
5.310 (General Chemistry Lab) Definitely not :)
Do you have any experience culturing cells (mammalian, yeast or microbial)?
No
Do you have any experience in molecular biology (electrophoresis, PCR, etc)?
No
Please briefly describe any previous laboratory experience
I worked in a lab with HST. I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO. I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them. I did not get to work with any of the cells (staining, passaging) or do any work under the hood, but I got to do a lot of work leading up to that and making it possible!
Anything else you would like us to know?
I am basically a clean slate, as you can tell, and I am excited to get my hands on some good biology!