User:Benji Moncivaiz: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(9 intermediate revisions by the same user not shown)
Line 9: Line 9:
*[[Special:Emailuser/Benji Moncivaiz|Email me through OpenWetWare]]
*[[Special:Emailuser/Benji Moncivaiz|Email me through OpenWetWare]]


I work in the [[Your Lab]] at XYZ University.  I learned about [[OpenWetWare]] from mit, and I've joined because team project.
==Mod2==
Day1: Protein Engineering with PCR assignment
 
Forward primer:
FLAP     landing sequence
5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA  tccatggaaaagagaagatg 3’
 
Reverse Primer:
FLAP                   landing sequence
5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT  tacgactcactatagggcga 3’
 
 


==Education==
==Education==
Line 43: Line 54:
Benji
Benji
===Course/Minor===
===Course/Minor===
2/(20&4)  
2 / (20&4)
 
===Year of Graduation===
===Year of Graduation===
2011
2011
Line 52: Line 64:


===Have you taken or are you taking...===
===Have you taken or are you taking...===
7.05/5.07 (Biochemistry)<br> Not yet.
7.05/5.07 (Biochemistry) Not yet. <br>
7.06 (Cell Biology)<br> No.
7.06 (Cell Biology) No. <br>
7.02 (General Biology Lab)<br> No.
7.02 (General Biology Lab) Nope. <br>
5.310 (General Chemistry Lab)<br> No - Biology is for me.
5.310 (General Chemistry Lab) Definitely not :) <br>  


Do you have any experience culturing cells (mammalian, yeast or microbial)?<br>  No
Do you have any experience culturing cells (mammalian, yeast or microbial)?<br>  No
Line 62: Line 74:


===Please briefly describe any previous laboratory experience===
===Please briefly describe any previous laboratory experience===
I worked in a lab with HST.  I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO.  I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them.  I did not get to work with any of the cells (staining, passaging) or much work under the hood, but I got to do a lot of work leading up to that and making it possible.
I worked in a lab with HST.  I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO.  I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them.  I did not get to work with any of the cells (staining, passaging) or do any work under the hood, but I got to do a lot of work leading up to that and making it possible!
 
 


===Anything else you would like us to know?===
===Anything else you would like us to know?===
 
I am basically a clean slate, as you can tell, and I am excited to get my hands on some good biology!


==Useful links==
==Useful links==
*[[OpenWetWare:Welcome|Introductory tutorial]]
*[[OpenWetWare:Welcome|Introductory tutorial]]
*[[Help|OpenWetWare help pages]]
*[[Help|OpenWetWare help pages]]

Latest revision as of 19:26, 6 November 2010

Contact Info

Benji Moncivaiz (an artistic interpretation)

Mod2

Day1: Protein Engineering with PCR assignment

Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’

Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’


Education

  • Year, PhD, Institute
  • Year, MS, Institute
  • Year, BS, Institute

Research interests

  1. Interest 1
  2. Interest 2
  3. Interest 3

Publications

  1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 | PubMed ID:6947258 | HubMed [Paper1]
  2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 | PubMed ID:13718526 | HubMed [Paper2]

    leave a comment about a paper here

  3. ISBN:0879697164 [Book1]

All Medline abstracts: PubMed | HubMed

Please copy the source code from this page to your user page, fill in the answers and print out a copy for next time.
You do not need to keep the information on your user page once you've printed it out.

Registration/Questionnaire: 20.109 Fall 2008

Last Name

Moncivaiz II

First Name

Benjamin

Preferred name

Benji

Course/Minor

2 / (20&4)

Year of Graduation

2011

Telephone #

Email

benmonci AT mit DOT edu

Have you taken or are you taking...

7.05/5.07 (Biochemistry) Not yet.
7.06 (Cell Biology) No.
7.02 (General Biology Lab) Nope.
5.310 (General Chemistry Lab) Definitely not :)

Do you have any experience culturing cells (mammalian, yeast or microbial)?
No

Do you have any experience in molecular biology (electrophoresis, PCR, etc)?
No

Please briefly describe any previous laboratory experience

I worked in a lab with HST. I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO. I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them. I did not get to work with any of the cells (staining, passaging) or do any work under the hood, but I got to do a lot of work leading up to that and making it possible!

Anything else you would like us to know?

I am basically a clean slate, as you can tell, and I am excited to get my hands on some good biology!

Useful links