User:Catherine Koenigsknecht/Notebook/Experimental Biological Chemistry/2011/11/01: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(5 intermediate revisions by the same user not shown)
Line 14: Line 14:


==Description==
==Description==
#15 uM stock solution BSA (10mg/mL) 2.5 mM solution Au (10mg/mL)
#15.5 uM stock solution BSA 2.9 mM solution HAuCl
# Make up four test tubes:
# Make up four test tubes:
*1. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (place in oven continuous)
*1. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (place in oven continuous)
Line 20: Line 20:
*3. 1 mL BSA 1 mL HCl 8 mL 3.6 pH Buffer solution (place in oven continuous)
*3. 1 mL BSA 1 mL HCl 8 mL 3.6 pH Buffer solution (place in oven continuous)
*4. 1 mL BSA 1 ml HCl 8 mL 3.6 pH Buffer solution (take out of oven)
*4. 1 mL BSA 1 ml HCl 8 mL 3.6 pH Buffer solution (take out of oven)
#Run PCR


==Data==
==Data==
* Add data and results here...
* Tube 1 had a clump of black (with a purplish tint) fibers.
* Tube 2 had more purplish fibers that were not clumped as much.
* Tubes 3&4 remained clear.


==Notes==
==Notes==
This area is for any observations or conclusions that you would like to note.
Place in oven at 12:51; take out 2 and 4 at 1:21
 
* Use Primers: DIC GFPcorr r(GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA); DIC GFPcorr f(TACgacgatgacgataagtgtcgatggggatccgaattc)
 
Use categories like tags. Change the "Course" category to the one corresponding to your course. The "Miscellaneous" tag can be used for particular experiments, as instructed by your professor. Please be sure to change or delete this tag as required so that the categories remain well organized.
 
[[Category:Course]]
[[Category:Miscellaneous]]
 




Revision as of 09:46, 26 December 2011

Biomaterials Design Lab <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Entry title

Objective

Synthesize Au nanoparticles using alternative method.

Description

  1. 15.5 uM stock solution BSA 2.9 mM solution HAuCl
  2. Make up four test tubes:
  • 1. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 2. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (take out of oven)
  • 3. 1 mL BSA 1 mL HCl 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 4. 1 mL BSA 1 ml HCl 8 mL 3.6 pH Buffer solution (take out of oven)
  1. Run PCR

Data

  • Tube 1 had a clump of black (with a purplish tint) fibers.
  • Tube 2 had more purplish fibers that were not clumped as much.
  • Tubes 3&4 remained clear.

Notes

Place in oven at 12:51; take out 2 and 4 at 1:21

  • Use Primers: DIC GFPcorr r(GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA); DIC GFPcorr f(TACgacgatgacgataagtgtcgatggggatccgaattc)



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Catherine_Koenigsknecht/Notebook/Experimental_Biological_Chemistry/2011/11/01&oldid=573846"