User:Catherine Koenigsknecht/Notebook/Experimental Biological Chemistry/2011/11/01

From OpenWetWare
Jump to navigationJump to search
Biomaterials Design Lab <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Entry title

Objective

Synthesize Au nanoparticles using alternative method.

Description

  1. 15.5 uM stock solution BSA 2.9 mM solution HAuCl
  2. Make up four test tubes:
  • 1. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 2. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (take out of oven)
  • 3. 1 mL BSA 1 mL HCl 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 4. 1 mL BSA 1 ml HCl 8 mL 3.6 pH Buffer solution (take out of oven)
  1. Run PCR

Data

  • Add data and results here...

Notes

Place in oven at 12:51; take out 2 and 4 at 1:21

  • Use Primers: DIC GFPcorr r(GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA); DIC GFPcorr f(TACgacgatgacgataagtgtcgatggggatccgaattc)



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Catherine_Koenigsknecht/Notebook/Experimental_Biological_Chemistry/2011/11/01&oldid=558691"