User:Catherine Koenigsknecht/Notebook/Experimental Biological Chemistry/2011/11/01

From OpenWetWare

< User:Catherine Koenigsknecht | Notebook | Experimental Biological Chemistry | 2011 | 11
Revision as of 12:46, 26 December 2011 by Catherine Koenigsknecht (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Biomaterials Design Lab Main project page
Previous entry      Next entry

Entry title

Objective

Synthesize Au nanoparticles using alternative method.

Description

  1. 15.5 uM stock solution BSA 2.9 mM solution HAuCl
  2. Make up four test tubes:
  • 1. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 2. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (take out of oven)
  • 3. 1 mL BSA 1 mL HCl 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 4. 1 mL BSA 1 ml HCl 8 mL 3.6 pH Buffer solution (take out of oven)
  1. Run PCR

Data

  • Tube 1 had a clump of black (with a purplish tint) fibers.
  • Tube 2 had more purplish fibers that were not clumped as much.
  • Tubes 3&4 remained clear.

Notes

Place in oven at 12:51; take out 2 and 4 at 1:21

  • Use Primers: DIC GFPcorr r(GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA); DIC GFPcorr f(TACgacgatgacgataagtgtcgatggggatccgaattc)



Personal tools