User:Chris D Hirst/Plasma
From OpenWetWare
m |
Current revision (20:12, 27 July 2010) (view source) m (→Cloning - In-Fusion™ (Similar to BBa T9002)) |
||
| (6 intermediate revisions not shown.) | |||
| Line 4: | Line 4: | ||
| - | While other programmes can do this, PlasmaDNA is free, very | + | While other programmes can do this, PlasmaDNA is free, very user friendly and produces highly detailed plasmid maps in 3 flavours. Some lab members already create PlasmaDNA (.pof) files for all the vectors and constructs they build. This, and the ability to visualise cloning, can prove very useful to aid understanding and debugging when issues arise. |
| Line 10: | Line 10: | ||
| - | This tutorial should also help to familiarise anyone unfamiliar with [http://blast.ncbi.nlm.nih.gov/Blast.cgi BLAST]<sup><cite>#2</cite></sup> searches. BLAST searches are | + | This tutorial should also help to familiarise anyone unfamiliar with [http://blast.ncbi.nlm.nih.gov/Blast.cgi BLAST]<sup><cite>#2</cite></sup> searches. BLAST searches are incredibly useful for identifying sequences, homolgy and checking sequencing results, just to name a few uses! If you are having difficulty with BLAST (particularly with how to interpret the results), most life-science members of the team should be pretty good with it. |
| - | + | ||
==Tutorial== | ==Tutorial== | ||
<br> | <br> | ||
| - | If you follow this tutorial, you should be able to use most of the features of PlasmaDNA. If you get stuck at any point, try having a play around with the programme! Most difficulties can easily be solved by trial and error. If you don't understand what you are doing (both with | + | If you follow this tutorial, you should be able to use most of the features of PlasmaDNA. If you get stuck at any point, try having a play around with the programme! Most difficulties can easily be solved by trial and error. If you don't understand what you are doing (both with PlasmaDNA and BLAST searching), let me know and I'll help you. |
| - | Be aware that | + | Be aware that although the story behind this is hypothetical (ie. fictional) it is not implausible. The Registry has improved its quality control so should now be far more reliable! |
| - | Your lab needs to produce and re-characterise BBa F2620 under a new set of conditions but has lost the original DNA of the testing construct (similar to BBa T9002). To make matters worse, someone has been prepping samples without keeping a back-up stock with the distribution, meaning that some of the ideal building components are missing. Fortunately there are other similar intermediates yet to be prepped that you can use to rebuild this. | + | Your lab needs to produce and re-characterise BBa F2620 under a new set of conditions but has lost the original DNA of the testing construct (similar to BBa T9002). To make matters worse, someone has been prepping samples without keeping a back-up stock with the distribution, meaning that some of the ideal building components are missing. Fortunately, there are other similar intermediates yet to be prepped that you can use to rebuild this. |
| - | Your supervisor reminds you that you are short on time so you decide to use three different methods ([http://partsregistry.org/Assembly:Standard_assembly Standard BioBricks Assembly], [http://partsregistry.org/Assembly:3A_Assembly 3A Assembly] and Clonetech™ In-Fusion<sup><cite>#3</cite></sup> - [http://www.clontech.com/images/pt/PT3941-1.pdf Figure 1] in this manual gives a good overview) to speed up | + | Your supervisor reminds you that you are short on time, so you decide to use three different methods ([http://partsregistry.org/Assembly:Standard_assembly Standard BioBricks Assembly], [http://partsregistry.org/Assembly:3A_Assembly 3A Assembly] and Clonetech™ In-Fusion<sup><cite>#3</cite></sup> - [http://www.clontech.com/images/pt/PT3941-1.pdf Figure 1] in this manual gives a good overview) to speed up your workflow. |
| - | Another student has attempted to get BBa F2620 from the | + | Another student has attempted to get BBa F2620 from the Registry plate and succesfully transformed the cells but upon gel analysis all their transformants contain an empty plasmid! It will be quicker, therefore, to make your test construct in two halves - BBa I13018 and BBa K116617 - and assemble them into the expression vector later. |
| Line 158: | Line 157: | ||
| - | To assemble this, R0040 and I0462 must be cut ready for insertion into the plasmid back bone. In particular, R0040 mustbe cut front insert and I0462 must be cut back insert. The sequences of the two BioBricks can be found in this [http://www.openwetware.org/wiki/Image: | + | To assemble this, R0040 and I0462 must be cut ready for insertion into the plasmid back bone. In particular, R0040 mustbe cut front insert and I0462 must be cut back insert. The sequences of the two BioBricks can be found in this [http://www.openwetware.org/wiki/Image:I13018_Components.pof .pof file]. |
| Line 172: | Line 171: | ||
[[Image:Plasma_Tutorial2.PNG|thumb|right|300px| Potential In-Fusion™ or other PCR based Assembly method output]] | [[Image:Plasma_Tutorial2.PNG|thumb|right|300px| Potential In-Fusion™ or other PCR based Assembly method output]] | ||
| - | ===Cloning - In-Fusion™ (Similar to T9002)=== | + | ===Cloning - In-Fusion™ (Similar to BBa T9002)=== |
<br> | <br> | ||
| Line 187: | Line 186: | ||
| - | *Which one of the two circular products is correct - this should be | + | *Which one of the two circular products is correct - this should be easy to spot if you look up T9002 and have fully labelled vectors! |
| Line 215: | Line 214: | ||
*Try blasting the entire sequence of the finished construct (in expression vector) against the nucleotide collection. What main reason would there be for using this expression vector (given the constructs location) rather than a normal BioBrick vector? | *Try blasting the entire sequence of the finished construct (in expression vector) against the nucleotide collection. What main reason would there be for using this expression vector (given the constructs location) rather than a normal BioBrick vector? | ||
| - | |||
===Exporting=== | ===Exporting=== | ||
Current revision
Contents |
Introduction
PlasmaDNA[1] is a free to use computer programme developed by the University of Helsinki to allow the easy mainpulation of DNA in silico. In the hands of an experience user, it can be used to fully plan out the assembly of a synthetic construct from base parts, genome sequences, cDNAs - basically any DNA input for which a text or FASTA file can be found. The ability to attempt a cloning strategm in silico before going into the lab can help identify bottlenecks and critical paths while allowing the user to visually see what they are producing.
While other programmes can do this, PlasmaDNA is free, very user friendly and produces highly detailed plasmid maps in 3 flavours. Some lab members already create PlasmaDNA (.pof) files for all the vectors and constructs they build. This, and the ability to visualise cloning, can prove very useful to aid understanding and debugging when issues arise.
PlasmaDNA can be accessed here.
This tutorial should also help to familiarise anyone unfamiliar with BLAST[2] searches. BLAST searches are incredibly useful for identifying sequences, homolgy and checking sequencing results, just to name a few uses! If you are having difficulty with BLAST (particularly with how to interpret the results), most life-science members of the team should be pretty good with it.
Tutorial
If you follow this tutorial, you should be able to use most of the features of PlasmaDNA. If you get stuck at any point, try having a play around with the programme! Most difficulties can easily be solved by trial and error. If you don't understand what you are doing (both with PlasmaDNA and BLAST searching), let me know and I'll help you.
Be aware that although the story behind this is hypothetical (ie. fictional) it is not implausible. The Registry has improved its quality control so should now be far more reliable!
Your lab needs to produce and re-characterise BBa F2620 under a new set of conditions but has lost the original DNA of the testing construct (similar to BBa T9002). To make matters worse, someone has been prepping samples without keeping a back-up stock with the distribution, meaning that some of the ideal building components are missing. Fortunately, there are other similar intermediates yet to be prepped that you can use to rebuild this.
Your supervisor reminds you that you are short on time, so you decide to use three different methods (Standard BioBricks Assembly, 3A Assembly and Clonetech™ In-Fusion[3] - Figure 1 in this manual gives a good overview) to speed up your workflow.
Another student has attempted to get BBa F2620 from the Registry plate and succesfully transformed the cells but upon gel analysis all their transformants contain an empty plasmid! It will be quicker, therefore, to make your test construct in two halves - BBa I13018 and BBa K116617 - and assemble them into the expression vector later.
Before starting, you decide to in silico test your cloning stratergy.
Resources
You have access to all the consumables you will need and the following BioBricks:
BBa pSB1C3 Backbone
Standard Expression Vector
Walkthrough
- As you are going through the tutorial, try to approxiamte how long you think each step would take in lab
Importing Sequences
PlasmaDNA can import sequences in one of three formats: Plain text, FASTA (similar to plain text) and .pof (Plasma) files.
To start off this tutuorial, enter the sequence of BBa R0062 (from the parts registry) and remember to add the BioBrick prefix and suffix!
Import a vector containing BBa E0240 from this .pof file
Restriction Enzyme, ORF and Primer Analysis
The Output viewer should already be open. If not, open it (button in the top left of the control panel) and look at the output of the two inputs. One should be a complete circular vector and one should be a short linear piece. The view is currently set to restriction analysis - ie. it shows all the restriction enzyme cutting sites on the sequences. Two alternative viewer modes are ORF analysis - this looks for Open Reading Frames (ie. coding regions) in the sequence according to a user set threshold (default is generally ok) and primer analysis - compares the input sequence to known primer sequences.
There are currently three known ORFs in E0240 and none in R0062, however the ORF analysis function indicates there is an extra coding region in E0240. Determine the nature of the coding region - either by part knowledge or using the blast function in the ORFs menu and add it to the current project.
Add the primers from this text file to this project on PlasmaDNA (using the add primer button not enter sequence button - Make sure you enter the binding sequence and 5' sequence correctly!), then look at the two fragments under primer analysis.
- Can you suggest a use for the pSB1 (A2/A3/AK3) and pSB1 Reverse (A2/A3/AK3) Primers? Is there anything odd about the primers which should be bared in mind when they are used?
Restriction Cloning - Biobricks RFC 10 (BBa K116617)
The first step, addition of R0062 and E0240 to make K116617 should be carried out using Standard BioBrick Assembly as this will maintain the scar present in K116617 (and T9002) and can be done in parallel to production of the other half.
Restriction Cloning should be carried out based on a procedure of Digestion to generate relevant insert and vector fragments and then ligation together (in lab, gel purification and PCR purification - to remove enzymes - would also be carried out between the digestion and the ligation).
- What enzymes will R0062 and E0240 need to be cut with for them to go together correctly?
Digest R0062 and E0240 (Digest! button) with the appropriate enzymes and select (effectively in silico purify) the correct fragment to keep. Now open the ligation window and attempt to ligate the two parts together.
- What is the final lab step in cloning before selection of correctly assembled products which isn't needed in silico?
- Approximately how long do you think each of these steps takes in lab?
Analysis of cloning results
The output of the ligation will be a plate of transformed cells. It is not necessarily true that all the transformants will contain correctly assembled DNA (in many cases, the majority will be incorrect - often 'background' ie. undigested or re-ligated vector. Usually a 'background plate' will also be transformed to give an idea of the numbers). It is therefore necessary to select for the correctly assembled DNA.
With a large number of transformants, a three step approach is the most appropriate (with a small number, skipping step one and going straight to mini-prep and gel analysis may be more appropriate).
The first step is clonoy PCR - simply put, PCR is carried out on all the DNA from a colony (obtained by boiling) to look for a correctly sized Multiple Cloning Site (MCS) - ie. the prefix, suffix and everything inbetween! Carry out PCR on the ligated fragment using the pSB Fwd and pSB Rev primers using the PCR window.
- Is the fragment approximately the right length for K116617?
- Is there any 'cheat' teachnique you could use to help you select for this correctly assembled DNA?
The second step is to mini-prep (lab only - grow up cells and extract plasmid DNA) and then use a restriction digest to check that the insert and vector are the correct sizes.
- How many enzymes would it be useful to use in this step and which ones would you choose?
Digest the ligated fragment using the digest button as before.
- Do the sizes of the vector and insert match what they should be?
The final step is the most important. Mutations occaisonally occur and can alter the function of your part or device if you are unlucky, therefore all parts that are made should be sequenced to ensure there has been no mutations (particularly when PCR has been used). Open the fragment and sequence information window and perform an Align BLAST Search[2] against the sequence of BBa K116617.
- Have any errors been picked up? If so are they important?
- Approximately how long do you think each of these steps takes in lab?
It may be useful for you to delete old, no longer needed fragments, or to re-name new fragments to stop confusion later. Both these functions can be carried out in the fragment sequence and information menu (Orange box in above diagram). Once you are sure you have validated that the part is correct, delete the old fragments and label the new ligation K116617.
3A Assembly - PCR and Biobricks (BBa I13018 )
To construct the I13018 past of the F2620 testing construct (simialr to T9002), it is necessary to combine BBa R0040 and BBa I0462.
For easy, speedy selection of correct transformants you decide it would be better to transform into a vector with a resistance other than Ampicillin when making the first half of the construct (I13018). By transforming by 3A Assembly into pSB1C3, correct transformants will be resitant to Chlorampheniol rathern than Ampicillin.
To assemble this, R0040 and I0462 must be cut ready for insertion into the plasmid back bone. In particular, R0040 mustbe cut front insert and I0462 must be cut back insert. The sequences of the two BioBricks can be found in this .pof file.
A vector is required to clone the pair of inserts. Plasmid backbones are now supplied along with the registry distribution and can be amplified by PCR. For submission, pSB1C3 is preferred so this should be amplified using the SB-3P and SB-2Ea primers. This amplified backbone can now be cut with EcoRI and PstI to allow ligation of the three pieces.
- What extra step between the PCR amplification and the EcoRI and PstI digestion would be required if this was carried out in lab?
The two cut inserts should first be ligated together, this will generate a linear product which can be ligated into the PCR amplified and cut vector. The resulting construct should be tested (in silico approximateion to selection) as before.
Cloning - In-Fusion™ (Similar to BBa T9002)
In Fusion™, like many PCR based methods relies on homology between two sequences of DNA and while PlasmaDNA is not designed with homology methods in mind, with a few work-arounds and use of Word, it can be adapted to make this method work.
The three regions with homology sequences should be generated using PCR with appropriate primers (Region 1 is I13018, Region 2 is K116617 and Region 3 is the Expression Vector) - see the primer text file.
The sequence of the expression vector can be found in this .pof file.
Upon generation of the three fragments, the two insert fragments should be ligated together, generating two circular products.
- Which one of the two circular products is correct - this should be easy to spot if you look up T9002 and have fully labelled vectors!
Select the right ligation of the pair - this will now have both inserts but with two copies of the homolgy regions! Either by eye, or by transfering the sequences to word, scan the sequence for the linking sequence pair - if the correct ligation was chosen, this will be a duplication in the middle eg.
ATGCTCGATCGATCGATCGATCGCGAGCTGATGATCAGTCGATCGATCAGGCTAGCTAGCTCTAGCTAGCTAGCTAGTATCAGCGAGCATTCTAGCGTACAGTCGATGCTCGATCGTAGTTGCTCGTTAT
One of the pair of homologus sequences should be removed to generate the correct sequence ie. -
ATGCTCGATCGATCGATCGATCGCGAGCTGATGATCAGTCGATCGATCAGGCTAGCTAGCTAGCTAGTATCAGCGAGCATTCTAGCGTACAGTCGATGCTCGATCGTAGTTGCTCGTTAT
Once this has been done, the sequence should be amplified again by PCR using the forward primer of region 1 and the reverse primer of region 2 and the resulting fragment ligated together. Spotting the ligation will be more difficult this time, the simplest method is to add both, then check the first and last 20 bases.
- How can the first and last 20 bases be used to spot if the chosen ligation was the correct one of the two?
When the right ligation has been selected, again remove the dupliacted homology regions. You should now have the finished testing construct in a suitable expression plasmid.
- The testing construct differs from the aimed for construct (BBa T9002) by the homology region in the middle of this construct. Is this homology region likely to alter the results which would be obtained from the non-standard part compared to T9002?
- Try blasting the entire sequence of the finished construct (in expression vector) against the nucleotide collection. What main reason would there be for using this expression vector (given the constructs location) rather than a normal BioBrick vector?
Exporting
Files can be exported in one of a few different formats - .pof files contain ALL the information included in the project, (including primer sequences and updated ORFs), FASTA files contaion just sequence information of the relevant DNA fragments or vectors and the other output format is JPEG which is useful if you want nice pictures for your wiki!
Simply click the export link to save your constructs!
References
- Angers-Loustau A, Rainy J, and Wartiovaara K. . pmid:17868482.
- Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ. . pmid:2231712.
- CloneTech™ In-Fusion


