User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/15: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(Autocreate 2014/04/15 Entry for User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors) |
(fix raw html notebook nav) |
||
(4 intermediate revisions by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Cell Fate Switch by Synthetic Transcription Factors</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Cell Fate Switch by Synthetic Transcription Factors</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
== | ==UPLassay== | ||
* | *This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences. | ||
==Reaction List== | |||
{| class="wikitable" style="width: 800px;" | |||
|- valign="top" | |||
| '''REACTION LIST''' | |||
{| width=300px | |||
|- | |||
| || '''Template cDNA''' || '''Gene Target''' | |||
|- | |||
| Rxn 1: || treated cells || PDX1 | |||
|- | |||
| Rxn 2: || treated cells || MAFA | |||
|- | |||
| Rxn 3: || treated cells || GLP1R | |||
|- | |||
| Rxn 4: || treated cells || PCSK1 | |||
|- | |||
| Rxn 5: || treated cells || IAPP | |||
|- | |||
| Rxn 6: || treated cells || KCNQ2 | |||
|- | |||
| Rxn 7: || treated cells || GAPD (reference gene) | |||
|- | |||
| Rxn 8: || untreated cells || PDX1 | |||
|- | |||
| Rxn 9: || untreated cells || MAFA | |||
|- | |||
| Rxn 10: || untreated cells || GLP1R | |||
|- | |||
| Rxn 11: || untreated cells || PCSK1 | |||
|- | |||
| Rxn 12: || untreated cells || IAPP | |||
|- | |||
| Rxn 13: || untreated cells || KCNQ2 | |||
|- | |||
| Rxn 14: || untreated cells || GAPD (reference gene) | |||
|- | |||
| Rxn 15: || no template || PDX1 | |||
|- | |||
| Rxn 16: || no template || MAFA | |||
|- | |||
| Rxn 17: || no template || GLP1R | |||
|- | |||
| Rxn 18: || no template || PCSK1 | |||
|- | |||
| Rxn 19: || no template || IAPP | |||
|- | |||
| Rxn 20: || no template || KCN2Q | |||
|- | |||
| Rxn 21: || no template || GAPD (reference gene) | |||
|} | |||
*Run 3 Each | |||
*45 Reactions Run | |||
*Using Variation 2 | |||
Variation 2<br> [[Image:Haynes_UPL_fig2.png|300px|Figure 1]] | |||
*Using as Reference, discount gene names on left side | |||
==Primers== | |||
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3 | |||
{| class="wikitable" style="width: 800px;" | |||
|- valign="top" | |||
| '''PRIMERS LIST''' | |||
{| width= 700px | |||
|- | |||
| || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe''' | |||
|- | |||
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa || #78, cat.no. 04689011001 | |||
|- | |||
| MAFA || NM_201589.3 || agcgagaagtgccaactcc || ttgtacaggtcccgctcttt || #39, cat.no. 04687973001 | |||
|- | |||
| GLP1R || NM_002062.3 || gtggcggccaattactactg || ggccagcagtgtgtacagg || #22, cat.no. 04686969001 | |||
|- | |||
| PCSK1 || NM_000439.4 || caagagcttgtgaaggacaaga || tctttcagccaagagcacag || #1, cat.no. 04684974001 | |||
|- | |||
| IAPP || NM_000415.2 || ttaccaaattgtagaggctttcg || ccctgcctctatacactcactacc || #77, cat.no. 04689003001 | |||
|- | |||
| KCNQ2(4) || NM_172108.3 || gacgtcatcgagcagtactca || cccacgatctggtccact || #56, cat.no. 04688538001 | |||
|- | |||
| GAPD (Ref) || NM_002046.3 || agccacatcgctcagacac || gcccaatacgaccaaatcc || #60, cat.no. 04688589001 | |||
|} | |||
==RT-PCR Mixes== | |||
'''Reaction set-up: PCR master mixes for each Gene Target'''<br> | |||
* Label one 1.5 mL tube per gene target | |||
* Make enough PCR master mix for your plate... | |||
** '''PDX1''' is in Reactions 1, 8, and 15 = 3 | |||
** Replicates per reaction = 3 | |||
** '''Master mix amount = 3 * 3 + 1 (to allow for pipetting error) = 10''' | |||
** The same needs to be done for MAFA, GLP1R, PCSK1, KCNQ2, IAPP and GAPD in separate tubes. | |||
{| class="wikitable" | |||
| <u>Reagent</u> || <u>(Single well)</u> || <u>Gene Target (x10)</u> || <u>GAPD (x10)</u> | |||
|- | |||
| 2x LC480 Probes Master || (7.5 μL) || 75.0 || 75.0 | |||
|- | |||
| 20 μM Forward primer || (0.3 μL) || 3.0 || 3.0 GAPD primers* | |||
|- | |||
| 20 μM Reverse primer || (0.3 μL) || 3.0 || --- | |||
|- | |||
| 10 μM UPL probe || (0.3 μL) || 3.0 || 3.0 GAPD UPL probe* | |||
|- | |||
| PCR H<sub>2</sub>O || (0.1 μL) || 1.0 || '''4.0''' | |||
|- | |||
| Total vol. || ('''8.5 μL''') || '''85.0''' || '''85.0''' | |||
|} | |||
''*GAPD primer mix and the GAPD UPL probe are supplied in the Roche Universal ProbeLibrary Human GAPD Assay kit, #05190541001'' | |||
Resulting 1.5 mL tubes: | |||
* '''PDX1''' - 85.0 μL | |||
* '''MAFA''' - 85.0 μL | |||
* '''GLP1R''' - 85.0 μL | |||
* '''PCSK1''' - 85.0 μL | |||
* '''KCNQ2''' - 85.0 μL | |||
* '''IAPP''' - 85.0 μL | |||
* '''GAPD''' - 85.0 μL | |||
---- | |||
'''Reaction set-up: master mixes for each Template'''<br> | |||
* Typically, you will have only 20 μL of stock cDNA on hand. | |||
* Make a 1:10 dilution of cDNA by adding 10 μL of the stock cDNA to 90 μL of PCR H<sub>2</sub>O. | |||
* Make enough Template master mix for your plate... | |||
** '''Treated cells cDNA''' is in Reactions 1, 2, 3, 4, 5, 6, 7 = 6 | |||
** Replicates per reaction = 3 | |||
** '''Master mix amount = 7 * 3 + 1 (to allow for pipetting error) = 22''' | |||
** The same needs to be done for templates "untreated cells" and "no template" in separate tubes. | |||
{| class="wikitable" | |||
| <u>Reagent</u> || <u>(Single well)</u> || <u>cDNA Template (x16)</u> | |||
|- | |||
| 1:10 cDNA dilution || (2.0 μL) || 44.0* | |||
|- | |||
| PCR H<sub>2</sub>O || (4.5 μL) || 99.0 | |||
|- | |||
| Total vol. || ('''6.5 μL''') || '''143.0''' | |||
|} | |||
''*For the no template control, use PCR H<sub>2</sub>O instead of cDNA.'' | |||
Resulting 1.5 mL tubes: | |||
* '''T1''' - treated cells cDNA, 84.5 μL | |||
* '''T2''' - untreated cells cDNA, 84.5 μL | |||
* '''T3''' - no template control, 84.5 μL | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> |
Latest revision as of 23:53, 26 September 2017
Cell Fate Switch by Synthetic Transcription Factors | Main project page Previous entry Next entry | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|