User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/15: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(2 intermediate revisions by the same user not shown) | |||
Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
==UPLassay== | |||
*This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences. | |||
==Reaction List== | |||
{| class="wikitable" style="width: 800px;" | |||
|- valign="top" | |||
| '''REACTION LIST''' | |||
{| width=300px | |||
|- | |||
| || '''Template cDNA''' || '''Gene Target''' | |||
|- | |||
| Rxn 1: || treated cells || PDX1 | |||
|- | |||
| Rxn 2: || treated cells || MAFA | |||
|- | |||
| Rxn 3: || treated cells || GLP1R | |||
|- | |||
| Rxn 4: || treated cells || PCSK1 | |||
|- | |||
| Rxn 5: || treated cells || IAPP | |||
|- | |||
| Rxn 6: || treated cells || KCNQ2 | |||
|- | |||
| Rxn 7: || treated cells || GAPD (reference gene) | |||
|- | |||
| Rxn 8: || untreated cells || PDX1 | |||
|- | |||
| Rxn 9: || untreated cells || MAFA | |||
|- | |||
| Rxn 10: || untreated cells || GLP1R | |||
|- | |||
| Rxn 11: || untreated cells || PCSK1 | |||
|- | |||
| Rxn 12: || untreated cells || IAPP | |||
|- | |||
| Rxn 13: || untreated cells || KCNQ2 | |||
|- | |||
| Rxn 14: || untreated cells || GAPD (reference gene) | |||
|- | |||
| Rxn 15: || no template || PDX1 | |||
|- | |||
| Rxn 16: || no template || MAFA | |||
|- | |||
| Rxn 17: || no template || GLP1R | |||
|- | |||
| Rxn 18: || no template || PCSK1 | |||
|- | |||
| Rxn 19: || no template || IAPP | |||
|- | |||
| Rxn 20: || no template || KCN2Q | |||
|- | |||
| Rxn 21: || no template || GAPD (reference gene) | |||
|} | |||
*Run 3 Each | |||
*45 Reactions Run | |||
*Using Variation 2 | |||
Variation 2<br> [[Image:Haynes_UPL_fig2.png|300px|Figure 1]] | |||
*Using as Reference, discount gene names on left side | |||
==Primers== | |||
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3 | |||
{| class="wikitable" style="width: 800px;" | |||
|- valign="top" | |||
| '''PRIMERS LIST''' | |||
{| width= 700px | |||
|- | |||
| || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe''' | |||
|- | |||
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa || #78, cat.no. 04689011001 | |||
|- | |||
| MAFA || NM_201589.3 || agcgagaagtgccaactcc || ttgtacaggtcccgctcttt || #39, cat.no. 04687973001 | |||
|- | |||
| GLP1R || NM_002062.3 || gtggcggccaattactactg || ggccagcagtgtgtacagg || #22, cat.no. 04686969001 | |||
|- | |||
| PCSK1 || NM_000439.4 || caagagcttgtgaaggacaaga || tctttcagccaagagcacag || #1, cat.no. 04684974001 | |||
|- | |||
| IAPP || NM_000415.2 || ttaccaaattgtagaggctttcg || ccctgcctctatacactcactacc || #77, cat.no. 04689003001 | |||
|- | |||
| KCNQ2(4) || NM_172108.3 || gacgtcatcgagcagtactca || cccacgatctggtccact || #56, cat.no. 04688538001 | |||
|- | |||
| GAPD (Ref) || NM_002046.3 || agccacatcgctcagacac || gcccaatacgaccaaatcc || #60, cat.no. 04688589001 | |||
|} | |||
==RT-PCR Mixes== | ==RT-PCR Mixes== | ||
'''Reaction set-up: PCR master mixes for each Gene Target'''<br> | '''Reaction set-up: PCR master mixes for each Gene Target'''<br> | ||
* Label one 1.5 mL tube per gene target | * Label one 1.5 mL tube per gene target | ||
* Make enough PCR master mix for your plate... | * Make enough PCR master mix for your plate... | ||
** ''' | ** '''PDX1''' is in Reactions 1, 8, and 15 = 3 | ||
** Replicates per reaction = 3 | ** Replicates per reaction = 3 | ||
** '''Master mix amount = 3 * 3 + 1 (to allow for pipetting error) = 10''' | ** '''Master mix amount = 3 * 3 + 1 (to allow for pipetting error) = 10''' | ||
** The same needs to be done for | ** The same needs to be done for MAFA, GLP1R, PCSK1, KCNQ2, IAPP and GAPD in separate tubes. | ||
Line 35: | Line 118: | ||
Resulting 1.5 mL tubes: | Resulting 1.5 mL tubes: | ||
* ''' | * '''PDX1''' - 85.0 μL | ||
* ''' | * '''MAFA''' - 85.0 μL | ||
* ''' | * '''GLP1R''' - 85.0 μL | ||
* ''' | * '''PCSK1''' - 85.0 μL | ||
* '''KCNQ2''' - 85.0 μL | |||
* '''IAPP''' - 85.0 μL | |||
* '''GAPD''' - 85.0 μL | * '''GAPD''' - 85.0 μL | ||
Line 47: | Line 132: | ||
* Make a 1:10 dilution of cDNA by adding 10 μL of the stock cDNA to 90 μL of PCR H<sub>2</sub>O. | * Make a 1:10 dilution of cDNA by adding 10 μL of the stock cDNA to 90 μL of PCR H<sub>2</sub>O. | ||
* Make enough Template master mix for your plate... | * Make enough Template master mix for your plate... | ||
** '''Treated cells cDNA''' is in Reactions 1, 2, 3, 4 | ** '''Treated cells cDNA''' is in Reactions 1, 2, 3, 4, 5, 6, 7 = 6 | ||
** Replicates per reaction = 3 | ** Replicates per reaction = 3 | ||
** '''Master mix amount = | ** '''Master mix amount = 7 * 3 + 1 (to allow for pipetting error) = 22''' | ||
** The same needs to be done for templates "untreated cells" and "no template" in separate tubes. | ** The same needs to be done for templates "untreated cells" and "no template" in separate tubes. | ||
Line 55: | Line 140: | ||
| <u>Reagent</u> || <u>(Single well)</u> || <u>cDNA Template (x16)</u> | | <u>Reagent</u> || <u>(Single well)</u> || <u>cDNA Template (x16)</u> | ||
|- | |- | ||
| 1:10 cDNA dilution || (2.0 μL) || | | 1:10 cDNA dilution || (2.0 μL) || 44.0* | ||
|- | |- | ||
| PCR H<sub>2</sub>O || (4.5 μL) || | | PCR H<sub>2</sub>O || (4.5 μL) || 99.0 | ||
|- | |- | ||
| Total vol. || ('''6.5 μL''') || ''' | | Total vol. || ('''6.5 μL''') || '''143.0''' | ||
|} | |} | ||
''*For the no template control, use PCR H<sub>2</sub>O instead of cDNA.'' | ''*For the no template control, use PCR H<sub>2</sub>O instead of cDNA.'' |
Revision as of 15:59, 18 April 2014
Cell Fate Switch by Synthetic Transcription Factors | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|