User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/15: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 93: Line 93:
* Label one 1.5 mL tube per gene target
* Label one 1.5 mL tube per gene target
* Make enough PCR master mix for your plate...  
* Make enough PCR master mix for your plate...  
** '''MPK14''' is in Reactions 1, 6, and 11 = 3
** '''PDX1''' is in Reactions 1, 6, and 11 = 3
** Replicates per reaction = 3
** Replicates per reaction = 3
** '''Master mix amount = 3 * 3 + 1 (to allow for pipetting error) = 10'''  
** '''Master mix amount = 3 * 3 + 1 (to allow for pipetting error) = 10'''  

Revision as of 15:43, 18 April 2014

Cell Fate Switch by Synthetic Transcription Factors <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

UPLassay

  • This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences.

Reaction List

REACTION LIST
  Template cDNA Gene Target
Rxn 1: treated cells PDX1
Rxn 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)
  • Run 3 Each
  • 45 Reactions Run
  • Using Variation 2

Variation 2
Figure 1

  • Using as Reference, discount gene names on left side

Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_000209.3 aagctcacgcgtggaaag gccgtgagatgtacttgttgaa #78, cat.no. 04689011001
MAFA NM_201589.3 agcgagaagtgccaactcc ttgtacaggtcccgctcttt #39, cat.no. 04687973001
GLP1R NM_002062.3 gtggcggccaattactactg ggccagcagtgtgtacagg #22, cat.no. 04686969001
PCSK1 NM_000439.4 caagagcttgtgaaggacaaga tctttcagccaagagcacag #1, cat.no. 04684974001
IAPP NM_000415.2 ttaccaaattgtagaggctttcg ccctgcctctatacactcactacc #77, cat.no. 04689003001
KCNQ2(4) NM_172108.3 gacgtcatcgagcagtactca cccacgatctggtccact #56, cat.no. 04688538001
GAPD (Ref) NM_002046.3 agccacatcgctcagacac gcccaatacgaccaaatcc #60, cat.no. 04688589001

RT-PCR Mixes

Reaction set-up: PCR master mixes for each Gene Target

  • Label one 1.5 mL tube per gene target
  • Make enough PCR master mix for your plate...
    • PDX1 is in Reactions 1, 6, and 11 = 3
    • Replicates per reaction = 3
    • Master mix amount = 3 * 3 + 1 (to allow for pipetting error) = 10
    • The same needs to be done for CBX8, TNF, NPPA, and GAPD in separate tubes.


Reagent (Single well) Gene Target (x10) GAPD (x10)
2x LC480 Probes Master (7.5 μL) 75.0 75.0
20 μM Forward primer (0.3 μL) 3.0 3.0 GAPD primers*
20 μM Reverse primer (0.3 μL) 3.0 ---
10 μM UPL probe (0.3 μL) 3.0 3.0 GAPD UPL probe*
PCR H2O (0.1 μL) 1.0 4.0
Total vol. (8.5 μL) 85.0 85.0

*GAPD primer mix and the GAPD UPL probe are supplied in the Roche Universal ProbeLibrary Human GAPD Assay kit, #05190541001


Resulting 1.5 mL tubes:

  • MPK14 - 85.0 μL
  • CBX8 - 85.0 μL
  • TNF - 85.0 μL
  • NPPA - 85.0 μL
  • GAPD - 85.0 μL

Reaction set-up: master mixes for each Template

  • Typically, you will have only 20 μL of stock cDNA on hand.
  • Make a 1:10 dilution of cDNA by adding 10 μL of the stock cDNA to 90 μL of PCR H2O.
  • Make enough Template master mix for your plate...
    • Treated cells cDNA is in Reactions 1, 2, 3, 4 and 5 = 5
    • Replicates per reaction = 3
    • Master mix amount = 5 * 3 + 1 (to allow for pipetting error) = 16
    • The same needs to be done for templates "untreated cells" and "no template" in separate tubes.
Reagent (Single well) cDNA Template (x16)
1:10 cDNA dilution (2.0 μL) 32.0*
PCR H2O (4.5 μL) 72.0
Total vol. (6.5 μL) 104.0

*For the no template control, use PCR H2O instead of cDNA.

Resulting 1.5 mL tubes:

  • T1 - treated cells cDNA, 84.5 μL
  • T2 - untreated cells cDNA, 84.5 μL
  • T3 - no template control, 84.5 μL
Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors/2014/04/15&oldid=789373"