User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/28

From OpenWetWare

Jump to: navigation, search
(Autocreate 2014/04/28 Entry for User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors)
Current revision (00:35, 29 April 2014) (view source)
(Entry title)
 
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
-
==Entry title==
+
==Primers==
-
* Insert content here...
+
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3
-
 
+
{| class="wikitable" style="width: 800px;"
-
 
+
|- valign="top"
 +
| '''PRIMERS LIST'''
 +
{| width= 700px
 +
|-
 +
| &nbsp; || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe'''
 +
|-
 +
| PDX1 || NM_008814.3 || gaaatccaccaaagctcacg || cgggttccgctgtgtaag || #51, cat.no.  04688481001
 +
|-
 +
| MAFA || NM_194350.1 || ctccagagccaggtggag || gtacaggtcccgctccttg || #10, cat.no. 04685091001
 +
|-
 +
| GLP1R || NM_021332.2 || gatgggctcctctcctatca || agatacacgccttccaccag || #15, cat.no. 04685148001
 +
|-
 +
| PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac ||  #42, cat.no. 04688015001
 +
|-
 +
| IAPP || NM_010491.2 || gatgtgcatctccaaactgc || tgtccatctgagggttgcta || #101, cat.no. 04692195001
 +
|-
 +
| KCNQ2 || NM_010611.2 || ctgggcgttcatctaccac || tggaaaacacagaaagcacaa || #2, cat.no. 04684982001
 +
|}
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}
__NOTOC__
__NOTOC__

Current revision

Cell Fate Switch by Synthetic Transcription Factors Main project page
Previous entry      Next entry

Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_008814.3 gaaatccaccaaagctcacg cgggttccgctgtgtaag #51, cat.no. 04688481001
MAFA NM_194350.1 ctccagagccaggtggag gtacaggtcccgctccttg #10, cat.no. 04685091001
GLP1R NM_021332.2 gatgggctcctctcctatca agatacacgccttccaccag #15, cat.no. 04685148001
PCSK1 NM_013628.2 tggagttgcatataattccaaagtt agcctcaatggcatcagttac #42, cat.no. 04688015001
IAPP NM_010491.2 gatgtgcatctccaaactgc tgtccatctgagggttgcta #101, cat.no. 04692195001
KCNQ2 NM_010611.2 ctgggcgttcatctaccac tggaaaacacagaaagcacaa #2, cat.no. 04684982001


Personal tools