User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/28

From OpenWetWare

Jump to: navigation, search
(Entry title)
Current revision (23:35, 28 April 2014) (view source)
(Entry title)

Current revision

Cell Fate Switch by Synthetic Transcription Factors Main project page
Previous entry      Next entry


  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_008814.3 gaaatccaccaaagctcacg cgggttccgctgtgtaag #51, 04688481001
MAFA NM_194350.1 ctccagagccaggtggag gtacaggtcccgctccttg #10, 04685091001
GLP1R NM_021332.2 gatgggctcctctcctatca agatacacgccttccaccag #15, 04685148001
PCSK1 NM_013628.2 tggagttgcatataattccaaagtt agcctcaatggcatcagttac #42, 04688015001
IAPP NM_010491.2 gatgtgcatctccaaactgc tgtccatctgagggttgcta #101, 04692195001
KCNQ2 NM_010611.2 ctgggcgttcatctaccac tggaaaacacagaaagcacaa #2, 04684982001

Personal tools