User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/04/28

From OpenWetWare

< User:David K. Barclay | Notebook | Controlling Pancreas Cell Fate Using Transcription Factors | 2014 | 04
Revision as of 00:35, 29 April 2014 by David K. Barclay (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Cell Fate Switch by Synthetic Transcription Factors Main project page
Previous entry      Next entry

Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_008814.3 gaaatccaccaaagctcacg cgggttccgctgtgtaag #51, cat.no. 04688481001
MAFA NM_194350.1 ctccagagccaggtggag gtacaggtcccgctccttg #10, cat.no. 04685091001
GLP1R NM_021332.2 gatgggctcctctcctatca agatacacgccttccaccag #15, cat.no. 04685148001
PCSK1 NM_013628.2 tggagttgcatataattccaaagtt agcctcaatggcatcagttac #42, cat.no. 04688015001
IAPP NM_010491.2 gatgtgcatctccaaactgc tgtccatctgagggttgcta #101, cat.no. 04692195001
KCNQ2 NM_010611.2 ctgggcgttcatctaccac tggaaaacacagaaagcacaa #2, cat.no. 04684982001


Personal tools