User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/10/27: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(Autocreate 2014/10/27 Entry for User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors)
 
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==Entry title==
==New Primers==
* Insert content here...
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3
 
*New Primers for next set of gene targets set on 10/27 from paper: "Generation of Functional Human Pancreatic Beta Cells In Vitro" (Pagliuca et al. 2014)
{| class="wikitable" style="width: 800px;"
|- valign="top"
| '''PRIMERS LIST'''
{| width= 700px
|-
| &nbsp; || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe'''
|-
| INS1 || NM_008386.3 || cagagaggaggtactttggactataaa || gccatgttgaaacaatgacct || 105, cat.no. 04692241001
|-
| NKX6-1 || NM_144955.2 || cccggagtgatgcagagt || gaacgtgggtctggtgtgtt || 103, cat.no. 04692217001
|-
| MNX1 || NM_019944.2 || gatgccggacttcagctc || agctgctggctggtgaag || 60, cat.no. 04688589001
|-
| SLC30A8 || NM_172816.3 || gctgcttcagcaatatgcttc || cagactcccagcaacgtgt  ||  53, cat.no. 04688503001
|-
| KLF9 || NM_010638.4 || ctcagaactgcttttaacattaggg || aacactttcctttttagctcgtg  || 32, cat.no. 04687655001
|-
| PCSK2 || NM_008792.4 || ggcgtgtttgcattagcttt || gcacagtcagatgttgcatgt || 85, cat.no. 04689097001
|}


<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Revision as of 14:34, 27 October 2014

Cell Fate Switch by Synthetic Transcription Factors <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

New Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
INS1 NM_008386.3 cagagaggaggtactttggactataaa gccatgttgaaacaatgacct 105, cat.no. 04692241001
NKX6-1 NM_144955.2 cccggagtgatgcagagt gaacgtgggtctggtgtgtt 103, cat.no. 04692217001
MNX1 NM_019944.2 gatgccggacttcagctc agctgctggctggtgaag 60, cat.no. 04688589001
SLC30A8 NM_172816.3 gctgcttcagcaatatgcttc cagactcccagcaacgtgt 53, cat.no. 04688503001
KLF9 NM_010638.4 ctcagaactgcttttaacattaggg aacactttcctttttagctcgtg 32, cat.no. 04687655001
PCSK2 NM_008792.4 ggcgtgtttgcattagcttt gcacagtcagatgttgcatgt 85, cat.no. 04689097001


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors/2014/10/27&oldid=838109"