User:Elaine Marie Robbins/Notebook/CHEM-496/2011/10/12

From OpenWetWare

< User:Elaine Marie Robbins | Notebook | CHEM-496 | 2011 | 10
Revision as of 12:38, 1 November 2011 by Elaine Marie Robbins (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Conductivity of AuNP II, DNA Sequencing Main project page
Previous entry      Next entry

Objective

Conductivity of AuNP II

To repeat the experiment on 10/11/11 and make electrodes to test the conductivity of MBP protein fibers containing AuNPs using a four point probe.


DNA Sequencing

To compare the mutant GFP DNA sequence purified on 10/05/11 to the wild type GFP DNA sequence to determine if the mutation is present.

Description

Conductivity of AuNP II

  1. Glue Pd wire onto Pd foil using conductive epoxy.
  2. Heat with heat gun until epoxy dries.
  3. Repeat with 3 more wires/foils.
  4. Glue wires/foils to Teflon plate with Instant Krazy Glue.
  5. When dry, plate AuNP-containing protein fibers onto the Teflon across the Pd foils.
  6. Allow the solvent to evaporate overnight.

DNA Sequencing

  1. Compare the obtained DNA sequence of GFP to the wild type DNA sequence from Invitrogen

Data

Conductivity of AuNP II

Areas of Pd foil used, from left to right: 35.20 mm2, 41.16 mm2, 40.18 mm2, 38.64 mm2.


DNA Sequencing

Obtained DNA sequence of mutant GFP, mutation site bold and underlined:

NNNNNNNNNNNTTTGTTNNACTTTAAGAAGGAGNTATACATATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCAT GACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGATCGATGGGGATCCGAATTCGCCACCATGGTGAGC AAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCG GCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC CCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCC ATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGG GCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAA CTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAG GACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACC TGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGAT CACTCTCGGCATGGACGAGCTGTACAAGTAACTCGAGAAGCTTGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCT GCTGCCACCGCTGANCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACT

The DNA sequence at the mutation site is identical to the wild type sequence. Therefore, the DNA was not mutated as intended.

Notes

Conductivity of AuNP II

Electrodes made on 10/11/11 were not functional because the conductive epoxy used did not successfully glue the Pd foil and wire to the Teflon surface.


DNA Sequencing

It was determined that the primers used to create the mutation in the GFP DNA sequence actually coded for the wild type GFP sequence. Thus, no mutation was possible.




Personal tools