User:Floriane Briere/Notebook/CHEM-496/2011/11/01: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(5 intermediate revisions by the same user not shown)
Line 18: Line 18:


* Gold NPs synthesis.
* Gold NPs synthesis.
# Tube 1: add 1ml of BSA stock solution + 1ml of HAuCl4 stock solution + 8ml of water
# Tube 1 (in this specific order): add 1ml of BSA stock solution (15.5µM) + 1ml of HAuCl4 stock solution (2.9mM) + 8ml of water
# Tube 2: add 1ml of BSA stock solution + 1ml of HCl stock solution + 8ml of water
# Tube 2 (in this specific order): add 1ml of HCl stock solution (3m) + 1ml of BSA stock solution (15.5µM) + 8ml of water
# Leave in the oven for 2 hours; remove every 30 minutes and leave at room temperature for 10 minutes


* PCR.
* PCR: we are using the same protocol as on the 20th of September but we are using different primers
# Add 5µL of 10X Pfu Buffer + 1µL of each primer + 1µL of DNA sample + 1µL of dNTP mix + 40µL of water + 1µL of Pfu Turbo + 50µL of Wax solution
# Place the tube in the thermocycler whose temperature cycling program is:
## 30 sec at 95°C
## 30 sec at 60°C
## 7 min at 72°C
## Repeat these three steps 19 times
## 10 min at 72°C
## Leave overnight at 4°C


==Data==
The forward primer is 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC3' and the reverse primer is 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA3'
* Add data and results here...


==Notes==
==Results==
This area is for any observations or conclusions that you would like to note.


In tube 1, we obtained an incolore solution with a black/dark purple aggregate.


Use categories like tags. Change the "Course" category to the one corresponding to your course. The "Miscellaneous" tag can be used for particular experiments, as instructed by your professor. Please be sure to change or delete this tag as required so that the categories remain well organized.
[[Image:1nov-GoldNPs result.jpg]]
 
 
In tube 2, nothing happened, the solution remained incolore and no fibers or filaments was formed.


[[Category:Course]]
[[Category:Course]]

Revision as of 17:20, 8 December 2011

File:BDLlogo notext ir.png Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>



Objective

Today we are going to conduct two different experiments:

  1. We are going to synthesize some Gold NPs again (tube 1) and we are going to investigate how the protein aggregate forms (tube 2; we are using an acidic solution to test if this property is responsible for the formation of the aggregate; the HAuCl4 is also an acidic solution).
  2. We are going to conduct a PCR again to produce some mutate proteins.

Protocol

  • Gold NPs synthesis.
  1. Tube 1 (in this specific order): add 1ml of BSA stock solution (15.5µM) + 1ml of HAuCl4 stock solution (2.9mM) + 8ml of water
  2. Tube 2 (in this specific order): add 1ml of HCl stock solution (3m) + 1ml of BSA stock solution (15.5µM) + 8ml of water
  3. Leave in the oven for 2 hours; remove every 30 minutes and leave at room temperature for 10 minutes
  • PCR: we are using the same protocol as on the 20th of September but we are using different primers
  1. Add 5µL of 10X Pfu Buffer + 1µL of each primer + 1µL of DNA sample + 1µL of dNTP mix + 40µL of water + 1µL of Pfu Turbo + 50µL of Wax solution
  2. Place the tube in the thermocycler whose temperature cycling program is:
    1. 30 sec at 95°C
    2. 30 sec at 60°C
    3. 7 min at 72°C
    4. Repeat these three steps 19 times
    5. 10 min at 72°C
    6. Leave overnight at 4°C

The forward primer is 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC3' and the reverse primer is 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA3'

Results

In tube 1, we obtained an incolore solution with a black/dark purple aggregate.


In tube 2, nothing happened, the solution remained incolore and no fibers or filaments was formed.