User:Floriane Briere/Notebook/CHEM-496/2011/11/01: Difference between revisions
From OpenWetWare
m (→Protocol) |
|||
(4 intermediate revisions by the same user not shown) | |||
Line 20: | Line 20: | ||
# Tube 1 (in this specific order): add 1ml of BSA stock solution (15.5µM) + 1ml of HAuCl4 stock solution (2.9mM) + 8ml of water | # Tube 1 (in this specific order): add 1ml of BSA stock solution (15.5µM) + 1ml of HAuCl4 stock solution (2.9mM) + 8ml of water | ||
# Tube 2 (in this specific order): add 1ml of HCl stock solution (3m) + 1ml of BSA stock solution (15.5µM) + 8ml of water | # Tube 2 (in this specific order): add 1ml of HCl stock solution (3m) + 1ml of BSA stock solution (15.5µM) + 8ml of water | ||
# Leave in the oven for 2 hours; remove every 30 minutes and leave at room temperature for 10 minutes | |||
* PCR: we are using the same protocol as on the 20th of September | * PCR: we are using the same protocol as on the 20th of September but we are using different primers | ||
# Add 5µL of 10X Pfu Buffer + 1µL of each primer + 1µL of DNA sample + 1µL of dNTP mix + 40µL of water + 1µL of Pfu Turbo + 50µL of Wax solution | |||
# Place the tube in the thermocycler whose temperature cycling program is: | |||
## 30 sec at 95°C | |||
## 30 sec at 60°C | |||
## 7 min at 72°C | |||
## Repeat these three steps 19 times | |||
## 10 min at 72°C | |||
## Leave overnight at 4°C | |||
The forward primer is 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC3' and the reverse primer is 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA3' | |||
== | ==Results== | ||
In tube 1, we obtained an incolore solution with a black/dark purple aggregate. | |||
[[Image:1nov-GoldNPs result.jpg]] | |||
In tube 2, nothing happened, the solution remained incolore and no fibers or filaments was formed. | |||
[[Category:Course]] | [[Category:Course]] |
Revision as of 17:20, 8 December 2011
File:BDLlogo notext ir.png Project name | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
ObjectiveToday we are going to conduct two different experiments:
Protocol
The forward primer is 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC3' and the reverse primer is 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA3' ResultsIn tube 1, we obtained an incolore solution with a black/dark purple aggregate.
|