User:Floriane Briere/Notebook/CHEM-496/2011/11/01

From OpenWetWare

< User:Floriane Briere | Notebook | CHEM-496 | 2011 | 11
Revision as of 20:20, 8 December 2011 by Floriane Briere (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Image:BDLlogo notext ir.png Project name Main project page
Previous entry      Next entry



Objective

Today we are going to conduct two different experiments:

  1. We are going to synthesize some Gold NPs again (tube 1) and we are going to investigate how the protein aggregate forms (tube 2; we are using an acidic solution to test if this property is responsible for the formation of the aggregate; the HAuCl4 is also an acidic solution).
  2. We are going to conduct a PCR again to produce some mutate proteins.

Protocol

  • Gold NPs synthesis.
  1. Tube 1 (in this specific order): add 1ml of BSA stock solution (15.5µM) + 1ml of HAuCl4 stock solution (2.9mM) + 8ml of water
  2. Tube 2 (in this specific order): add 1ml of HCl stock solution (3m) + 1ml of BSA stock solution (15.5µM) + 8ml of water
  3. Leave in the oven for 2 hours; remove every 30 minutes and leave at room temperature for 10 minutes
  • PCR: we are using the same protocol as on the 20th of September but we are using different primers
  1. Add 5µL of 10X Pfu Buffer + 1µL of each primer + 1µL of DNA sample + 1µL of dNTP mix + 40µL of water + 1µL of Pfu Turbo + 50µL of Wax solution
  2. Place the tube in the thermocycler whose temperature cycling program is:
    1. 30 sec at 95°C
    2. 30 sec at 60°C
    3. 7 min at 72°C
    4. Repeat these three steps 19 times
    5. 10 min at 72°C
    6. Leave overnight at 4°C

The forward primer is 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC3' and the reverse primer is 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA3'

Results

In tube 1, we obtained an incolore solution with a black/dark purple aggregate.

Image:1nov-GoldNPs result.jpg


In tube 2, nothing happened, the solution remained incolore and no fibers or filaments was formed.



Personal tools