User:Jakob G. Wells

Contact Info

Jakob G. Wells

• Jakob G. Wells
• Arizona State University
• 500 East University Drive
• Tempe, Arizona, United States
• Email me

I work in the Speedie and Associates lab at Speedie and Associates.

Education

• Currently seeking a Bachelors in Science and Engineering at Arizona State University

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.

http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png

Source: http://openpcr.org/use-it/

1. Interest 2
2. Interest 3

Publications

1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |

   leave a comment about a paper here

3. ISBN:0879697164

Useful links

• Introductory tutorial
• OpenWetWare help pages