User:Jessho

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 36: Line 36:
UROP, June 08 - Present, Lauffenburger Lab
UROP, June 08 - Present, Lauffenburger Lab
-
===Anything else you would like us to know?===
+
===SAGA-Related===
-
I love experiential learning, so I'm super excited about 20.109!
+
My Favorite Protein: YJR097W
 +
 
 +
<u>Primer Design</u>
 +
 
 +
Purpose: To design a primer to amplify a TAP TRP1 fusion gene.  After PCR, the fusion gene will have additional elements, i.e. homologous regions of the S. cerivisiae gene YGR097W flanking the TAP TRP1 gene, to enable C-terminus modification of YGR097W via homologous recombination.
 +
 
 +
Forward:
 +
5’- AAGGTTAATTTTGACATCGAGGAAGAGCAAGAAGGACAA TCC ATG GAA AAG AGA AGA TG - 3'
 +
 
 +
Backward:
 +
5'- AGATTTATCTGATATGCTCAATTTCCCCTCCCATTTTCA GAC TCA CTA TAG GGC GA - 3'

Revision as of 15:33, 8 October 2008

Jessica Ho

Contents

Last Name

Ho

First Name

Jessica

Preferred name

Jess

Course/Minor

20 and 8B. No minor, yet.

Year of Graduation

2010

Telephone #

(703) 623-2414

Email

jessho AT mit DOT edu

Have you taken or are you taking...

Completed 7.05/5.07 (Biochemistry)
Enrolled 7.06 (Cell Biology)
No 7.02 (General Biology Lab)
No 5.310 (General Chemistry Lab)

Do you have any experience culturing cells (mammalian, yeast or microbial)?
Yes

Do you have any experience in molecular biology (electrophoresis, PCR, etc)?
Yes

Please briefly describe any previous laboratory experience

Undergrad team member, MIT iGEM 2007 team UROP, June 08 - Present, Lauffenburger Lab

SAGA-Related

My Favorite Protein: YJR097W

Primer Design

Purpose: To design a primer to amplify a TAP TRP1 fusion gene. After PCR, the fusion gene will have additional elements, i.e. homologous regions of the S. cerivisiae gene YGR097W flanking the TAP TRP1 gene, to enable C-terminus modification of YGR097W via homologous recombination.

Forward: 5’- AAGGTTAATTTTGACATCGAGGAAGAGCAAGAAGGACAA TCC ATG GAA AAG AGA AGA TG - 3'

Backward: 5'- AGATTTATCTGATATGCTCAATTTCCCCTCCCATTTTCA GAC TCA CTA TAG GGC GA - 3'

Personal tools