User:Jessho

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (17:25, 12 November 2008) (view source)
 
Line 1: Line 1:
-
Jessica Ho
+
===Basics===
 +
Last name: Ho<br>
 +
First name: Jessica<br>
 +
Course/Minor: 20 and 8B.  No minor, yet.<br>
 +
Email:jessho AT mit DOT edu<br>
-
===Last Name===
+
Have you taken or are you taking...<br>
-
Ho
+
-
 
+
-
===First Name===
+
-
Jessica
+
-
 
+
-
===Preferred name===
+
-
Jess
+
-
 
+
-
===Course/Minor===
+
-
20 and 8B.  No minor, yet.
+
-
 
+
-
===Year of Graduation===
+
-
2010
+
-
 
+
-
===Telephone #===
+
-
(703) 623-2414
+
-
 
+
-
===Email===
+
-
jessho AT mit DOT edu
+
-
 
+
-
===Have you taken or are you taking...===
+
Completed 7.05/5.07 (Biochemistry)<br>
Completed 7.05/5.07 (Biochemistry)<br>
Enrolled 7.06 (Cell Biology)<br>
Enrolled 7.06 (Cell Biology)<br>
Line 28: Line 11:
No 5.310 (General Chemistry Lab)<br>
No 5.310 (General Chemistry Lab)<br>
-
Do you have any experience culturing cells (mammalian, yeast or microbial)?<br>    Yes
+
Do you have any experience culturing cells (mammalian, yeast or microbial)? Yes
-
Do you have any experience in molecular biology (electrophoresis, PCR, etc)?<br>  Yes
+
Do you have any experience in molecular biology (electrophoresis, PCR, etc)? Yes
-
===Please briefly describe any previous laboratory experience===
+
Please briefly describe any previous laboratory experience<br>
-
Undergrad team member, MIT iGEM 2007 team
+
Undergrad team member, MIT iGEM 2007 team<br>
UROP, June 08 - Present, Lauffenburger Lab
UROP, June 08 - Present, Lauffenburger Lab
-
===SAGA-Related===
+
===20.109 Mod 2 - SAGA-Related info===
My Favorite Protein: YJR097W
My Favorite Protein: YJR097W

Current revision

Basics

Last name: Ho
First name: Jessica
Course/Minor: 20 and 8B. No minor, yet.
Email:jessho AT mit DOT edu

Have you taken or are you taking...
Completed 7.05/5.07 (Biochemistry)
Enrolled 7.06 (Cell Biology)
No 7.02 (General Biology Lab)
No 5.310 (General Chemistry Lab)

Do you have any experience culturing cells (mammalian, yeast or microbial)? Yes

Do you have any experience in molecular biology (electrophoresis, PCR, etc)? Yes

Please briefly describe any previous laboratory experience
Undergrad team member, MIT iGEM 2007 team
UROP, June 08 - Present, Lauffenburger Lab

20.109 Mod 2 - SAGA-Related info

My Favorite Protein: YJR097W

Primer Design

Purpose: To design a primer to amplify a TAP TRP1 fusion gene. After PCR, the fusion gene will have additional elements, i.e. homologous regions of the S. cerivisiae gene YGR097W flanking the TAP TRP1 gene, to enable C-terminus modification of YGR097W via homologous recombination.

Forward: 5’- AAGGTTAATTTTGACATCGAGGAAGAGCAAGAAGGACAA TCC ATG GAA AAG AGA AGA TG - 3'

Backward: 5'- AGATTTATCTGATATGCTCAATTTCCCCTCCCATTTTCA GAC TCA CTA TAG GGC GA - 3'

20.109 Mod 3 Research Proposal

Investigating the proteins with which extracellular Hsp90 interacts. Click here for more info

Personal tools