User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02
From OpenWetWare
< User:Karmella Haynes | Notebook | BioBrick cloning | 2013 | 01(Difference between revisions)
Current revision (22:03, 2 January 2013) (view source) (→01/02/13) |
|||
| (2 intermediate revisions not shown.) | |||
| Line 10: | Line 10: | ||
* Gibson assembly: order primers for vector pSB1A3 | * Gibson assembly: order primers for vector pSB1A3 | ||
* Golden Gate assembly: order primers for pSB1A3 and Brady's parts | * Golden Gate assembly: order primers for pSB1A3 and Brady's parts | ||
| - | * Order enzyme for Golden gate assembly: | + | * Order enzyme for Golden gate assembly: BsmBI |
---- | ---- | ||
'''Gibson Assembly design''' | '''Gibson Assembly design''' | ||
| - | * Previously tried to ligate Gibson insert into X/S cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly. | + | * Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly. |
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences: | * Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences: | ||
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix) | ** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix) | ||
| Line 27: | Line 27: | ||
'''Golden Gate design''' | '''Golden Gate design''' | ||
| + | * Use '''BsmBI''', per Dave Savage's recommendation | ||
| + | ** cgtctc - 5bp overlap - part - 5bp overlap - gcagaga | ||
| + | ** Forward - 5'-cgtctc NNNNN+20bp TOP | ||
| + | ** Reverse - 5'-cgtctc nnnnn+20bp rev comp | ||
| + | |||
| + | New primers | ||
| + | # gg_BBS F: 5'-'''cgtctc'''actagtagcggccgctgcag (should also work for V0120) | ||
| + | # gg_BBP R: 5'-'''cgtctc'''tctagatgcggccgcgaattc (should also work for V0120) | ||
| + | # gg_BBP-hPCD F: 5'-'''cgtctc'''CTAGAtggagctttcagcggtggg | ||
| + | # gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg | ||
| + | # gg_BL01 F: 5'-'''cgtctc'''atggagctttcagcggtggg | ||
| + | # gg_BL01-BBS R: 5'-'''cgtctc'''CTAGTgccaggatcccccgagcccc | ||
| + | |||
| + | |||
| + | |||
Current revision
Main project page Previous entry Next entry
| |
01/02/13
Gibson Assembly design
New primers designed to amplify pSB1A3 backbone (should also work for V0120)
Golden Gate design
New primers
| |



