User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(→01/02/13)
Line 10: Line 10:
* Gibson assembly: order primers for vector pSB1A3
* Gibson assembly: order primers for vector pSB1A3
* Golden Gate assembly: order primers for pSB1A3 and Brady's parts
* Golden Gate assembly: order primers for pSB1A3 and Brady's parts
-
* Order enzyme for Golden gate assembly:  
+
* Order enzyme for Golden gate assembly: BsmBI
----
----
'''Gibson Assembly design'''
'''Gibson Assembly design'''
-
* Previously tried to ligate Gibson insert into X/S cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
+
* Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
Line 27: Line 27:
'''Golden Gate design'''
'''Golden Gate design'''
 +
* Use '''BsmBI''', per Dave Savage's recommendation
 +
** cgtctc - 5bp overlap - part - 5bp overlap - gcagaga
 +
** Forward - 5'-cgtctc NNNNN+20bp TOP
 +
** Reverse - 5'-cgtctc nnnnn+20bp rev comp
 +
 +
New primers
 +
# gg_BBS F: 5'-'''cgtctc'''actagtagcggccgctgcag (should also work for V0120)
 +
# gg_BBP R: 5'-'''cgtctc'''tctagatgcggccgcgaattc (should also work for V0120)
 +
# gg_BBP-hPCD F: 5'-'''cgtctc'''CTAGAtggagctttcagcggtggg
 +
# gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg
 +
# gg_
 +

Revision as of 21:52, 2 January 2013

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

01/02/13

  • Gibson assembly: order primers for vector pSB1A3
  • Golden Gate assembly: order primers for pSB1A3 and Brady's parts
  • Order enzyme for Golden gate assembly: BsmBI


Gibson Assembly design

  • Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
  • Retry assembly "hPCD-BL01" (see [1]). Make sure primer sequence overlaps with Brady's external sequences:
    • BBP-hPCD fwd: gaattcgcggccgcttctaga-tggagctttcagcggtggg (first 21 = BioBrick prefix)
    • BL01-BBS rev: ctgcagcggccgctactagt-gccaggatcccccgagcccc (first 20 = BioBrick suffix)

New primers designed to amplify pSB1A3 backbone (should also work for V0120)

  1. Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
  2. Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)


Golden Gate design

  • Use BsmBI, per Dave Savage's recommendation
    • cgtctc - 5bp overlap - part - 5bp overlap - gcagaga
    • Forward - 5'-cgtctc NNNNN+20bp TOP
    • Reverse - 5'-cgtctc nnnnn+20bp rev comp

New primers

  1. gg_BBS F: 5'-cgtctcactagtagcggccgctgcag (should also work for V0120)
  2. gg_BBP R: 5'-cgtctctctagatgcggccgcgaattc (should also work for V0120)
  3. gg_BBP-hPCD F: 5'-cgtctcCTAGAtggagctttcagcggtggg
  4. gg_hPCD-BL01 R: 5'-cgtctcTCCATtctttccctttcctcaaagg
  5. gg_





Retrieved from "http://www.openwetware.org/wiki/User:Karmella_Haynes/Notebook/BioBrick_cloning/2013/01/02"
Personal tools