User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(fix raw html notebook nav)
 
(4 intermediate revisions by one other user not shown)
Line 2: Line 2:
|-
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}}
|-
|-
| colspan="2"|
| colspan="2"|
Line 10: Line 10:
* Gibson assembly: order primers for vector pSB1A3
* Gibson assembly: order primers for vector pSB1A3
* Golden Gate assembly: order primers for pSB1A3 and Brady's parts
* Golden Gate assembly: order primers for pSB1A3 and Brady's parts
* Order enzyme for Golden gate assembly:  
* Order enzyme for Golden gate assembly: BsmBI




----
----
'''Gibson Assembly design'''<br>
'''Gibson Assembly design'''
* Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix)
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix)
#  
 
New primers designed to amplify pSB1A3 backbone (should also work for V0120)
# Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
# Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)
 
 
 
'''Golden Gate design'''
* Use '''BsmBI''', per Dave Savage's recommendation
** cgtctc - 5bp overlap - part - 5bp overlap - gcagaga
** Forward - 5'-cgtctc NNNNN+20bp TOP
** Reverse - 5'-cgtctc nnnnn+20bp rev comp
 
New primers
# gg_BBS F: 5'-'''cgtctc'''actagtagcggccgctgcag (should also work for V0120)
# gg_BBP R: 5'-'''cgtctc'''tctagatgcggccgcgaattc (should also work for V0120)
# gg_BBP-hPCD F: 5'-'''cgtctc'''CTAGAtggagctttcagcggtggg
# gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg
# gg_BL01 F: 5'-'''cgtctc'''atggagctttcagcggtggg
# gg_BL01-BBS R: 5'-'''cgtctc'''CTAGTgccaggatcccccgagcccc
 
 




'''Primers: Golden Gate'''




Latest revision as of 22:20, 26 September 2017

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

01/02/13

  • Gibson assembly: order primers for vector pSB1A3
  • Golden Gate assembly: order primers for pSB1A3 and Brady's parts
  • Order enzyme for Golden gate assembly: BsmBI


Gibson Assembly design

  • Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
  • Retry assembly "hPCD-BL01" (see [1]). Make sure primer sequence overlaps with Brady's external sequences:
    • BBP-hPCD fwd: gaattcgcggccgcttctaga-tggagctttcagcggtggg (first 21 = BioBrick prefix)
    • BL01-BBS rev: ctgcagcggccgctactagt-gccaggatcccccgagcccc (first 20 = BioBrick suffix)

New primers designed to amplify pSB1A3 backbone (should also work for V0120)

  1. Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
  2. Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)


Golden Gate design

  • Use BsmBI, per Dave Savage's recommendation
    • cgtctc - 5bp overlap - part - 5bp overlap - gcagaga
    • Forward - 5'-cgtctc NNNNN+20bp TOP
    • Reverse - 5'-cgtctc nnnnn+20bp rev comp

New primers

  1. gg_BBS F: 5'-cgtctcactagtagcggccgctgcag (should also work for V0120)
  2. gg_BBP R: 5'-cgtctctctagatgcggccgcgaattc (should also work for V0120)
  3. gg_BBP-hPCD F: 5'-cgtctcCTAGAtggagctttcagcggtggg
  4. gg_hPCD-BL01 R: 5'-cgtctcTCCATtctttccctttcctcaaagg
  5. gg_BL01 F: 5'-cgtctcatggagctttcagcggtggg
  6. gg_BL01-BBS R: 5'-cgtctcCTAGTgccaggatcccccgagcccc






Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Karmella_Haynes/Notebook/BioBrick_cloning/2013/01/02&oldid=1011717"