User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(mm/dd/yy)
(01/02/13)
Line 8: Line 8:
==01/02/13==
==01/02/13==
<!-- Precede finished items with a checkmark &#x2713; -->
<!-- Precede finished items with a checkmark &#x2713; -->
-
* Gibson assembly: order primers for vector V0120
+
* Gibson assembly: order primers for vector pSB1A3
-
* Line item 2
+
* Golden Gate assembly: order primers for pSB1A3 and Brady's parts
 +
* Order enzyme for Golden gate assembly:
----
----
-
'''Minipreps'''<br>
+
'''Gibson Assembly design'''<br>
-
* Check with E/P digests
+
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
 +
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
 +
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix)
 +
#
-
{| {{table}} border="1" cellspacing="3" <!-- Digest check rxn. table -->
 
-
|- valign="top"
 
-
| bgcolor=#cfcfcf | Reagent
 
-
| bgcolor=#cfcfcf | Volume
 
-
| rowspan="7" | <u>Expected:</u><br>1. BB 1 = size<br>2. BB2 = size<br>
 
-
| rowspan="7" | <!-- [[Image:GelImage.jpg|400px|Hover name]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
 
-
|-
 
-
| DNA(plasmid) || 2.0 μL
 
-
|-
 
-
| 10X buffer || 1.5
 
-
|-
 
-
| EcoRI || 1.0
 
-
|-
 
-
| PstI || 1.0
 
-
|-
 
-
| dH<sub>2</sub>O || 9.5
 
-
|-
 
-
| &nbsp; || 15 μL --> 37°C/ ~15 min.
 
-
|}
 
-
----
+
'''Primers: Golden Gate'''
-
'''Assemblies'''
+
-
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
+
-
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
+
-
* Digests (Fermentas FD)
 
-
** Specific notes
 
-
 
-
{| {{table}} cellspacing="3" <!-- Digest rxn. table -->
 
-
|- valign="top"
 
-
| bgcolor=#cfcfcf | Reagent
 
-
| bgcolor=#cfcfcf | Volume
 
-
| rowspan="7" | <!-- [[Image:GelImage.jpg|270px|Hover name]]<br>30 μL/lane, 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
 
-
|-
 
-
| DNA (plasmid) || up to 25 μL
 
-
|-
 
-
| 10x buffer || 3.0
 
-
|-
 
-
| enzyme 1 || 1.0
 
-
|-
 
-
| enzyme 2 || 1.0
 
-
|-
 
-
| dH<sub>2</sub>O || ---
 
-
|-
 
-
| &nbsp; || 30 μL --> 37°C/ ~30 min.
 
-
|}
 
-
 
-
 
-
* Measure conc.'s
 
-
{| {{table}} cellspacing="3" <!-- [DNA] table -->
 
-
|- bgcolor=#cfcfcf
 
-
| Sample || OD260 || 260/280 || ng/μL
 
-
|-
 
-
| 1. Digested part (a/b) || --- || --- || ---
 
-
|-
 
-
| 2. Digested part (c/d) || --- || --- || ---
 
-
|}
 
-
 
-
 
-
* Dephosphorylation (Roche)
 
-
{| {{table}} cellspacing="3" <!-- Dephos table -->
 
-
|-
 
-
| bgcolor=#cfcfcf | Reagent
 
-
| bgcolor=#cfcfcf | Volume
 
-
|-
 
-
| DNA (clean digest) || up to 17 μL (500 ng)
 
-
|-
 
-
| 10x buffer d.p. || 2.0
 
-
|-
 
-
| phosphatase || 1.0
 
-
|-
 
-
| dH<sub>2</sub>O || ---
 
-
|-
 
-
| &nbsp; || 20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL
 
-
|}
 
-
 
-
 
-
* Ligations
 
-
{| {{table}} cellspacing="3" <!-- Ligations table -->
 
-
|- bgcolor=#cfcfcf
 
-
| Ligation || <font color="blue"><u>Plate results (lig : neg crtl)</u> mm/dd/yy</font>
 
-
|-
 
-
| 1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng || <font color="blue">new BioBrick #:1 (Pick #)</font>
 
-
|-
 
-
| 2. vector(c/d)/ ## ng || &nbsp;
 
-
|}
 
-
 
-
{| {{table}} cellspacing="3" <!-- Ligation rxn table -->
 
-
| &nbsp;            || 1    || 2    ||
 
-
|-
 
-
| Insert DNA        || ###  || ---  ||
 
-
|-
 
-
| Vector DNA        || ###  || ###  ||
 
-
|-
 
-
| 2x lgn buf (Roche) || ###  || ###  ||
 
-
|-
 
-
| T4 ligase (NEB)    || 1.0  || 1.0  ||
 
-
|-
 
-
| dH<sub>2</sub>O    || ###  || ###  ||
 
-
|-
 
-
| &nbsp;            || # μL || # μL ||
 
-
|}
 
-
 
-
----
 
-
'''Oligo annealing'''
 
-
# New BB 1
 
-
# New BB 2
 
-
 
-
{| class="wikitable" border="0" cellspacing="3" <!-- Oligo annealing rxn table -->
 
-
| DNA (oligos, 100 μM) || up to 18 μL (3 μL ea.)
 
-
|-
 
-
| 10x annealing buffer || 2.0
 
-
|-
 
-
| dH<sub>2</sub>O || ---
 
-
|-
 
-
| &nbsp; || 20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight
 
-
|}
 

Revision as of 19:46, 2 January 2013

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

01/02/13

  • Gibson assembly: order primers for vector pSB1A3
  • Golden Gate assembly: order primers for pSB1A3 and Brady's parts
  • Order enzyme for Golden gate assembly:



Gibson Assembly design

  • Retry assembly "hPCD-BL01" (see [1]). Make sure primer sequence overlaps with Brady's external sequences:
    • BBP-hPCD fwd: gaattcgcggccgcttctaga-tggagctttcagcggtggg (first 21 = BioBrick prefix)
    • BL01-BBS rev: ctgcagcggccgctactagt-gccaggatcccccgagcccc (first 20 = BioBrick suffix)


Primers: Golden Gate




Personal tools