User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02: Difference between revisions
From OpenWetWare
No edit summary |
|||
Line 14: | Line 14: | ||
---- | ---- | ||
'''Gibson Assembly design''' | '''Gibson Assembly design''' | ||
* Previously tried to ligate Gibson insert into X/S cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly. | |||
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences: | * Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences: | ||
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix) | ** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix) | ||
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix) | ** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix) | ||
New primers designed to amplify pSB1A3 backbone (should also work for V0120) | |||
# Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix) | |||
# Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix) | |||
'''Golden Gate design''' | |||
Revision as of 17:59, 2 January 2013
Karmella's BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
01/02/13
Gibson Assembly design
New primers designed to amplify pSB1A3 backbone (should also work for V0120)
Golden Gate design
|