User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(→01/02/13)
Line 14: Line 14:
----
----
-
'''Gibson Assembly design'''<br>
+
'''Gibson Assembly design'''
 +
* Previously tried to ligate Gibson insert into X/S cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences:
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix)
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix)
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix)
-
#
 
 +
New primers designed to amplify pSB1A3 backbone (should also work for V0120)
 +
# Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
 +
# Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)
 +
 +
 +
 +
'''Golden Gate design'''
-
'''Primers: Golden Gate'''
 

Revision as of 20:59, 2 January 2013

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

01/02/13

  • Gibson assembly: order primers for vector pSB1A3
  • Golden Gate assembly: order primers for pSB1A3 and Brady's parts
  • Order enzyme for Golden gate assembly:


Gibson Assembly design

  • Previously tried to ligate Gibson insert into X/S cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
  • Retry assembly "hPCD-BL01" (see [1]). Make sure primer sequence overlaps with Brady's external sequences:
    • BBP-hPCD fwd: gaattcgcggccgcttctaga-tggagctttcagcggtggg (first 21 = BioBrick prefix)
    • BL01-BBS rev: ctgcagcggccgctactagt-gccaggatcccccgagcccc (first 20 = BioBrick suffix)

New primers designed to amplify pSB1A3 backbone (should also work for V0120)

  1. Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
  2. Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)


Golden Gate design




Retrieved from "http://www.openwetware.org/wiki/User:Karmella_Haynes/Notebook/BioBrick_cloning/2013/01/02"
Personal tools