User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(04/14/13)
(04/14/13)
Line 29: Line 29:
<font style="courier">
<font style="courier">
-
<u>CTAGT</u>CCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
+
<u>CTAGT</u>CCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAG<u>A</u>
-
&nbsp; &nbsp; AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC</font>
+
&nbsp; &nbsp; <u>A</u>GGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTC<u>TGATC</u></font>
# 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
# 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC

Revision as of 20:29, 14 March 2013

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

04/14/13

  • New vector: design new vector for mammalian expression
  • Order oligos



New mammalian expression vector MV9 and MV10

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
  • MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number

Oligator results:

  • Custom prefix top = ctagt
  • Custom prefix bottom = a
  • Custom suffix top = a
  • Custom suffix bottom = tgatc


CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA     AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC

  1. 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
  2. 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
  3. 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGA
  4. 30-mer 5'-CTAGTCTCAGCTTTACGCGTGATGGTGGTG




Personal tools