User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14

From OpenWetWare

< User:Karmella Haynes | Notebook | BioBrick cloning | 2013 | 03(Difference between revisions)
Jump to: navigation, search
(04/14/13)
Current revision (15:45, 9 April 2013) (view source)
(04/14/13)
 
(7 intermediate revisions not shown.)
Line 8: Line 8:
==04/14/13==
==04/14/13==
<!-- Precede finished items with a checkmark &#x2713; -->
<!-- Precede finished items with a checkmark &#x2713; -->
-
* New vectors: design new vectors for mammalian expression
+
* New vector: design new vector for mammalian expression
* Order oligos
* Order oligos
----
----
-
'''New mammalian expression vectors MV9 and MV10'''<br>
+
'''New mammalian expression vector MV9'''<br>
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
-
** MV9 - will carry Kozak-XbaI-NLS-6His-stop (Brady's and Behzad's project)
+
* MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
-
** MV10 - will carry Kozak-XbaI-stop
+
** The XbaI site will be used to accept X/S inserts; plasmid digests will be needed to check proper orientation
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
-
* Inserts will be ligated to XbaI cut MV6 to destroy the preexisting XbaI site
+
* Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
* Clones will be screened for proper orientation and insert copy number
* Clones will be screened for proper orientation and insert copy number
 +
Oligator results:
Oligator results:
 +
* Custom prefix top = ctagt
 +
* Custom prefix bottom = a
 +
* Custom suffix top = a
 +
* Custom suffix bottom = tgatc
-
'''Kozak-XbaI-NLS-6His-stop'''<br>
 
-
<font style="courier">
 
-
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
 
-
&nbsp; &nbsp; AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC</font>
 
-
# 30-mer 5'-CTAGTCCCGCCGCCACCATGGAGTCTAGAC
+
<font face="courier">
-
# 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
+
<u>ctagtCCCGCCGCCACCATGGAGTCTAGAC</u>CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa<br>
-
# 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGA
+
&nbsp; &nbsp; aGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTA<u>GTGGTGGTAGTGCGCATTTCGACTCtgatc</u></font><br>
-
# 30-mer 5'-CTAGTCTCAGCTTTACGCGTGATGGTGGTG
+
-
'''Kozak-XbaI-stop'''<br>
+
# 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
 +
# 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
 +
# 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGa
 +
# 30-mer 5'-ctagtCTCAGCTTTACGCGTGATGGTGGTG
-
 
-
----
 
-
'''Assemblies'''
 
-
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
 
-
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
 
-
 
-
 
-
* Digests (Fermentas FD)
 
-
** Specific notes
 
-
 
-
{| {{table}} cellspacing="3" <!-- Digest rxn. table -->
 
-
|- valign="top"
 
-
| bgcolor=#cfcfcf | Reagent
 
-
| bgcolor=#cfcfcf | Volume
 
-
| rowspan="7" | <!-- [[Image:GelImage.jpg|270px|Hover name]]<br>30 μL/lane, 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
 
-
|-
 
-
| DNA (plasmid) || up to 25 μL
 
-
|-
 
-
| 10x buffer || 3.0
 
-
|-
 
-
| enzyme 1 || 1.0
 
-
|-
 
-
| enzyme 2 || 1.0
 
-
|-
 
-
| dH<sub>2</sub>O || ---
 
-
|-
 
-
| &nbsp; || 30 μL --> 37°C/ ~30 min.
 
-
|}
 
-
 
-
 
-
* Measure conc.'s
 
-
{| {{table}} cellspacing="3" <!-- [DNA] table -->
 
-
|- bgcolor=#cfcfcf
 
-
| Sample || OD260 || 260/280 || ng/μL
 
-
|-
 
-
| 1. Digested part (a/b) || --- || --- || ---
 
-
|-
 
-
| 2. Digested part (c/d) || --- || --- || ---
 
-
|}
 
-
 
-
 
-
* Dephosphorylation (Roche)
 
-
{| {{table}} cellspacing="3" <!-- Dephos table -->
 
-
|-
 
-
| bgcolor=#cfcfcf | Reagent
 
-
| bgcolor=#cfcfcf | Volume
 
-
|-
 
-
| DNA (clean digest) || up to 17 μL (500 ng)
 
-
|-
 
-
| 10x buffer d.p. || 2.0
 
-
|-
 
-
| phosphatase || 1.0
 
-
|-
 
-
| dH<sub>2</sub>O || ---
 
-
|-
 
-
| &nbsp; || 20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL
 
-
|}
 
-
 
-
 
-
* Ligations
 
-
{| {{table}} cellspacing="3" <!-- Ligations table -->
 
-
|- bgcolor=#cfcfcf
 
-
| Ligation || <font color="blue"><u>Plate results (lig : neg crtl)</u> mm/dd/yy</font>
 
-
|-
 
-
| 1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng || <font color="blue">new BioBrick #:1 (Pick #)</font>
 
-
|-
 
-
| 2. vector(c/d)/ ## ng || &nbsp;
 
-
|}
 
-
 
-
{| {{table}} cellspacing="3" <!-- Ligation rxn table -->
 
-
| &nbsp;            || 1    || 2    ||
 
-
|-
 
-
| Insert DNA        || ###  || ---  ||
 
-
|-
 
-
| Vector DNA        || ###  || ###  ||
 
-
|-
 
-
| 2x lgn buf (Roche) || ###  || ###  ||
 
-
|-
 
-
| T4 ligase (NEB)    || 1.0  || 1.0  ||
 
-
|-
 
-
| dH<sub>2</sub>O    || ###  || ###  ||
 
-
|-
 
-
| &nbsp;            || # μL || # μL ||
 
-
|}
 
-
 
-
----
 
-
'''Oligo annealing'''
 
-
# New BB 1
 
-
# New BB 2
 
-
 
-
{| class="wikitable" border="0" cellspacing="3" <!-- Oligo annealing rxn table -->
 
-
| DNA (oligos, 100 μM) || up to 18 μL (3 μL ea.)
 
-
|-
 
-
| 10x annealing buffer || 2.0
 
-
|-
 
-
| dH<sub>2</sub>O || ---
 
-
|-
 
-
| &nbsp; || 20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight
 
-
|}
 

Current revision

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

04/14/13

  • New vector: design new vector for mammalian expression
  • Order oligos



New mammalian expression vector MV9

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
  • MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
    • The XbaI site will be used to accept X/S inserts; plasmid digests will be needed to check proper orientation
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number


Oligator results:

  • Custom prefix top = ctagt
  • Custom prefix bottom = a
  • Custom suffix top = a
  • Custom suffix bottom = tgatc


ctagtCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
    aGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCtgatc

  1. 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
  2. 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
  3. 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGa
  4. 30-mer 5'-ctagtCTCAGCTTTACGCGTGATGGTGGTG




Personal tools