User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14

From OpenWetWare

< User:Karmella Haynes | Notebook | BioBrick cloning | 2013 | 03(Difference between revisions)
Jump to: navigation, search
(04/14/13)
Current revision (16:45, 9 April 2013) (view source)
(04/14/13)
 
(6 intermediate revisions not shown.)
Line 13: Line 13:
----
----
-
'''New mammalian expression vector MV9 and MV10'''<br>
+
'''New mammalian expression vector MV9'''<br>
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
* MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
* MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
 +
** The XbaI site will be used to accept X/S inserts; plasmid digests will be needed to check proper orientation
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
* Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
* Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
* Clones will be screened for proper orientation and insert copy number
* Clones will be screened for proper orientation and insert copy number
 +
Oligator results:
Oligator results:
 +
* Custom prefix top = ctagt
 +
* Custom prefix bottom = a
 +
* Custom suffix top = a
 +
* Custom suffix bottom = tgatc
 +
-
'''Kozak-XbaI-NLS-6His-stop'''<br>
+
<font face="courier">
-
<font style="courier">
+
<u>ctagtCCCGCCGCCACCATGGAGTCTAGAC</u>CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa<br>
-
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
+
&nbsp; &nbsp; aGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTA<u>GTGGTGGTAGTGCGCATTTCGACTCtgatc</u></font><br>
-
&nbsp; &nbsp; AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC</font>
+
-
# 30-mer 5'-CTAGTCCCGCCGCCACCATGGAGTCTAGAC
+
# 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
-
# 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
+
# 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
-
# 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGA
+
# 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGa
-
# 30-mer 5'-CTAGTCTCAGCTTTACGCGTGATGGTGGTG
+
# 30-mer 5'-ctagtCTCAGCTTTACGCGTGATGGTGGTG

Current revision

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

04/14/13

  • New vector: design new vector for mammalian expression
  • Order oligos



New mammalian expression vector MV9

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
  • MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
    • The XbaI site will be used to accept X/S inserts; plasmid digests will be needed to check proper orientation
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number


Oligator results:

  • Custom prefix top = ctagt
  • Custom prefix bottom = a
  • Custom suffix top = a
  • Custom suffix bottom = tgatc


ctagtCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
    aGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCtgatc

  1. 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
  2. 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
  3. 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGa
  4. 30-mer 5'-ctagtCTCAGCTTTACGCGTGATGGTGGTG




Personal tools