User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(fix raw html notebook nav)
 
(9 intermediate revisions by one other user not shown)
Line 2: Line 2:
|-
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}}
|-
|-
| colspan="2"|
| colspan="2"|
Line 8: Line 8:
==04/14/13==
==04/14/13==
<!-- Precede finished items with a checkmark &#x2713; -->
<!-- Precede finished items with a checkmark &#x2713; -->
* New vectors: design new vectors for mammalian expression
* New vector: design new vector for mammalian expression
* Order oligos
* Order oligos




----
----
'''New mammalian expression vectors MV9 and MV10'''<br>
'''New mammalian expression vector MV9'''<br>


* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
** MV9 - will carry Kozak-XbaI-NLS-6His-stop (Brady's and Behzad's project)
* MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
** MV10 - will carry Kozak-XbaI-stop
** The XbaI site will be used to accept X/S inserts; plasmid digests will be needed to check proper orientation
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
* Inserts will be ligated to XbaI cut MV6 to destroy the preexisting XbaI site
* Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
* Clones will be screened for proper orientation and insert copy number
* Clones will be screened for proper orientation and insert copy number


Oligator results:
Oligator results:
* Custom prefix top = ctagt
* Custom prefix bottom = a
* Custom suffix top = a
* Custom suffix bottom = tgatc


'''Kozak-XbaI-NLS-6His-stop'''<br>
<font style="courier">
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
&nbsp; &nbsp; AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC</font>
----
'''Assemblies'''
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
* Digests (Fermentas FD)
** Specific notes
{| {{table}} cellspacing="3" <!-- Digest rxn. table -->
|- valign="top"
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Volume
| rowspan="7" | <!-- [[Image:GelImage.jpg|270px|Hover name]]<br>30 μL/lane, 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
|-
| DNA (plasmid) || up to 25 μL
|-
| 10x buffer || 3.0
|-
| enzyme 1 || 1.0
|-
| enzyme 2 || 1.0
|-
| dH<sub>2</sub>O || ---
|-
| &nbsp; || 30 μL --> 37°C/ ~30 min.
|}


<font face="courier">
<u>ctagtCCCGCCGCCACCATGGAGTCTAGAC</u>CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa<br>
&nbsp; &nbsp; aGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTA<u>GTGGTGGTAGTGCGCATTTCGACTCtgatc</u></font><br>


* Measure conc.'s
# 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
{| {{table}} cellspacing="3" <!-- [DNA] table -->
# 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
|- bgcolor=#cfcfcf
# 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGa
| Sample || OD260 || 260/280 || ng/μL
# 30-mer 5'-ctagtCTCAGCTTTACGCGTGATGGTGGTG
|-
| 1. Digested part (a/b) || --- || --- || ---
|-
| 2. Digested part (c/d) || --- || --- || ---
|}




* Dephosphorylation (Roche)
{| {{table}} cellspacing="3" <!-- Dephos table -->
|-
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Volume
|-
| DNA (clean digest) || up to 17 μL (500 ng)
|-
| 10x buffer d.p. || 2.0
|-
| phosphatase || 1.0
|-
| dH<sub>2</sub>O || ---
|-
| &nbsp; || 20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL
|}
* Ligations
{| {{table}} cellspacing="3" <!-- Ligations table -->
|- bgcolor=#cfcfcf
| Ligation || <font color="blue"><u>Plate results (lig : neg crtl)</u> mm/dd/yy</font>
|-
| 1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng || <font color="blue">new BioBrick #:1 (Pick #)</font>
|-
| 2. vector(c/d)/ ## ng || &nbsp;
|}
{| {{table}} cellspacing="3" <!-- Ligation rxn table -->
| &nbsp;            || 1    || 2    ||
|-
| Insert DNA        || ###  || ---  ||
|-
| Vector DNA        || ###  || ###  ||
|-
| 2x lgn buf (Roche) || ###  || ###  ||
|-
| T4 ligase (NEB)    || 1.0  || 1.0  ||
|-
| dH<sub>2</sub>O    || ###  || ###  ||
|-
| &nbsp;            || # μL || # μL ||
|}
----
'''Oligo annealing'''
# New BB 1
# New BB 2
{| class="wikitable" border="0" cellspacing="3" <!-- Oligo annealing rxn table -->
| DNA (oligos, 100 μM) || up to 18 μL (3 μL ea.)
|-
| 10x annealing buffer || 2.0
|-
| dH<sub>2</sub>O || ---
|-
| &nbsp; || 20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight
|}




Latest revision as of 22:32, 26 September 2017

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

04/14/13

  • New vector: design new vector for mammalian expression
  • Order oligos


New mammalian expression vector MV9

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
  • MV9 - will carry Kozak-XbaI-NLS-6His-stop (for Brady's and Behzad's projects)
    • The XbaI site will be used to accept X/S inserts; plasmid digests will be needed to check proper orientation
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Insert will be ligated to XbaI-cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number


Oligator results:

  • Custom prefix top = ctagt
  • Custom prefix bottom = a
  • Custom suffix top = a
  • Custom suffix bottom = tgatc


ctagtCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
    aGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCtgatc

  1. 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC
  2. 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGa
  3. 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGa
  4. 30-mer 5'-ctagtCTCAGCTTTACGCGTGATGGTGGTG




Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Karmella_Haynes/Notebook/BioBrick_cloning/2013/03/14&oldid=1012205"