User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(Autocreate 2013/03/14 Entry for User:Karmella_Haynes/Notebook/BioBrick_cloning)
 
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==mm/dd/yy==
==04/14/13==
<!-- Precede finished items with a checkmark &#x2713; -->
<!-- Precede finished items with a checkmark &#x2713; -->
* Line item 1
* New vectors: design new vectors for mammalian expression
* Line item 2
* Order oligos




----
----
'''Minipreps'''<br>
'''New mammalian expression vectors MV9 and MV10'''<br>
* Check with E/P digests
 
* Use the [http://gcat.davidson.edu/igem10/ Oligator tool] to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
** MV9 - will carry Kozak-XbaI-NLS-6His-stop (Brady's and Behzad's project)
** MV10 - will carry Kozak-XbaI-stop
* Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
* Inserts will be ligated to XbaI cut MV6 to destroy the preexisting XbaI site
* Clones will be screened for proper orientation and insert copy number
 
Oligator results:
 
'''Kozak-XbaI-NLS-6His-stop'''<br>
<font style="courier">
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
&nbsp; &nbsp; AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC</font>
 


{| {{table}} border="1" cellspacing="3" <!-- Digest check rxn. table -->
|- valign="top"
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Volume
| rowspan="7" | <u>Expected:</u><br>1. BB 1 = size<br>2. BB2 = size<br>
| rowspan="7" | <!-- [[Image:GelImage.jpg|400px|Hover name]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
|-
| DNA(plasmid) || 2.0 μL
|-
| 10X buffer || 1.5
|-
| EcoRI || 1.0
|-
| PstI || 1.0
|-
| dH<sub>2</sub>O || 9.5
|-
| &nbsp; || 15 μL --> 37°C/ ~15 min.
|}


----
----

Revision as of 18:07, 14 March 2013

Karmella's BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

04/14/13

  • New vectors: design new vectors for mammalian expression
  • Order oligos


New mammalian expression vectors MV9 and MV10

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
    • MV9 - will carry Kozak-XbaI-NLS-6His-stop (Brady's and Behzad's project)
    • MV10 - will carry Kozak-XbaI-stop
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Inserts will be ligated to XbaI cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number

Oligator results:

Kozak-XbaI-NLS-6His-stop
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA     AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC


Assemblies

  1. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
  2. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size


  • Digests (Fermentas FD)
    • Specific notes
Reagent Volume
DNA (plasmid) up to 25 μL
10x buffer 3.0
enzyme 1 1.0
enzyme 2 1.0
dH2O ---
  30 μL --> 37°C/ ~30 min.


  • Measure conc.'s
Sample OD260 260/280 ng/μL
1. Digested part (a/b) --- --- ---
2. Digested part (c/d) --- --- ---


  • Dephosphorylation (Roche)
Reagent Volume
DNA (clean digest) up to 17 μL (500 ng)
10x buffer d.p. 2.0
phosphatase 1.0
dH2O ---
  20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL


  • Ligations
Ligation Plate results (lig : neg crtl) mm/dd/yy
1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng new BioBrick #:1 (Pick #)
2. vector(c/d)/ ## ng  
  1 2
Insert DNA ### ---
Vector DNA ### ###
2x lgn buf (Roche) ### ###
T4 ligase (NEB) 1.0 1.0
dH2O ### ###
  # μL # μL

Oligo annealing

  1. New BB 1
  2. New BB 2
DNA (oligos, 100 μM) up to 18 μL (3 μL ea.)
10x annealing buffer 2.0
dH2O ---
  20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Karmella_Haynes/Notebook/BioBrick_cloning/2013/03/14&oldid=683136"