User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
Karmella's BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

04/14/13

  • New vectors: design new vectors for mammalian expression
  • Order oligos


New mammalian expression vectors MV9 and MV10

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
    • MV9 - will carry Kozak-XbaI-NLS-6His-stop (Brady's and Behzad's project)
    • MV10 - will carry Kozak-XbaI-stop
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Inserts will be ligated to XbaI cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number

Oligator results:

Kozak-XbaI-NLS-6His-stop
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA     AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC


Assemblies

  1. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
  2. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size


  • Digests (Fermentas FD)
    • Specific notes
Reagent Volume
DNA (plasmid) up to 25 μL
10x buffer 3.0
enzyme 1 1.0
enzyme 2 1.0
dH2O ---
  30 μL --> 37°C/ ~30 min.


  • Measure conc.'s
Sample OD260 260/280 ng/μL
1. Digested part (a/b) --- --- ---
2. Digested part (c/d) --- --- ---


  • Dephosphorylation (Roche)
Reagent Volume
DNA (clean digest) up to 17 μL (500 ng)
10x buffer d.p. 2.0
phosphatase 1.0
dH2O ---
  20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL


  • Ligations
Ligation Plate results (lig : neg crtl) mm/dd/yy
1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng new BioBrick #:1 (Pick #)
2. vector(c/d)/ ## ng  
  1 2
Insert DNA ### ---
Vector DNA ### ###
2x lgn buf (Roche) ### ###
T4 ligase (NEB) 1.0 1.0
dH2O ### ###
  # μL # μL

Oligo annealing

  1. New BB 1
  2. New BB 2
DNA (oligos, 100 μM) up to 18 μL (3 μL ea.)
10x annealing buffer 2.0
dH2O ---
  20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Karmella_Haynes/Notebook/BioBrick_cloning/2013/03/14&oldid=683136"