User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14

From OpenWetWare

Jump to: navigation, search
Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

04/14/13

  • New vectors: design new vectors for mammalian expression
  • Order oligos



New mammalian expression vectors MV9 and MV10

  • Use the Oligator tool to design oligo-assembly inserts for "MV6" (pcDNA3.1+ puro, mammalian transfection vector; CMV promoter)
    • MV9 - will carry Kozak-XbaI-NLS-6His-stop (Brady's and Behzad's project)
    • MV10 - will carry Kozak-XbaI-stop
  • Oligo assembly method will be used to make double stranded DNA with SpeI overhangs
  • Inserts will be ligated to XbaI cut MV6 to destroy the preexisting XbaI site
  • Clones will be screened for proper orientation and insert copy number

Oligator results:

Kozak-XbaI-NLS-6His-stop
CTAGTCCCGCCGCCACCATGGAGTCTAGACCCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA     AGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTCTGATC

  1. 30-mer 5'-CTAGTCCCGCCGCCACCATGGAGTCTAGAC
  2. 52-mer 5'-CCAAGAAAAAGCGCAAGGTACACCATCACCACCATCACGCGTAAAGCTGAGA
  3. 52-mer 5'-ATGGTGTACCTTGCGCTTTTTCTTGGGTCTAGACTCCATGGTGGCGGCGGGA
  4. 30-mer 5'-CTAGTCTCAGCTTTACGCGTGATGGTGGTG

Kozak-XbaI-stop



Assemblies

  1. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
  2. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size


  • Digests (Fermentas FD)
    • Specific notes
Reagent Volume
DNA (plasmid) up to 25 μL
10x buffer 3.0
enzyme 1 1.0
enzyme 2 1.0
dH2O ---
  30 μL --> 37°C/ ~30 min.


  • Measure conc.'s
Sample OD260 260/280 ng/μL
1. Digested part (a/b) --- --- ---
2. Digested part (c/d) --- --- ---


  • Dephosphorylation (Roche)
Reagent Volume
DNA (clean digest) up to 17 μL (500 ng)
10x buffer d.p. 2.0
phosphatase 1.0
dH2O ---
  20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL


  • Ligations
Ligation Plate results (lig : neg crtl) mm/dd/yy
1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng new BioBrick #:1 (Pick #)
2. vector(c/d)/ ## ng  
  1 2
Insert DNA ### ---
Vector DNA ### ###
2x lgn buf (Roche) ### ###
T4 ligase (NEB) 1.0 1.0
dH2O ### ###
  # μL # μL

Oligo annealing

  1. New BB 1
  2. New BB 2
DNA (oligos, 100 μM) up to 18 μL (3 μL ea.)
10x annealing buffer 2.0
dH2O ---
  20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight



Personal tools