User:Kateryna Kozyrytska

From OpenWetWare

Revision as of 17:41, 6 November 2008 by Patrick Wu (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

I am a new member of OpenWetWare!

Contents

Contact Info

Kateryna Kozyrytska (an artistic interpretation)
Kateryna Kozyrytska (an artistic interpretation)

I study at MIT. I learned about OpenWetWare from professor, and I've joined because I am taking a class that requires an account.

Education

  • SB 2011, MIT

Research interests

YGR067C: ATGGCTGCGGGTCAAAAAAAATATATATGTTCCTTTTGTTTGAAGCCTTTCTCGAGATCC GAGCACAAGATAAGGCATGAAAGGTCTCATGCGGGCGTGAAGCCTTTCCAGTGCCAAGTC TGTAAACACTCTTTTGTTAGACGCGATCTCTTACAGCGACACATCAGGACTGTCCACAGA ACCTTCCTCTTATCCAGTTACGCGTCAATGACAGGCGATAAGGCTGATATCCCTGTATCA CTTGGCGTTGGTGACGTTGATTCGACTTCACCCAGAGATATCAAAATGGAAACACTCGTT AATTCGATGATTAAGGTCAACAGCGGCCTTATCAATATTCACTATCATAGTAGTAATGTT GAAAAAATGGATAAGCAGCAACGTTGTGTGATTGGGAAGGAGTCCTCTAGTTTAAAGAAA GGGAAAAGCCGCTTTAAGCAGGTTAAAAGCCGGTTGGAGTCCTCCATCAGTGTAAAAATT TTGCAAGAATATTCATTAGATTTTATTAGCTCAAGAGATATTCTAACTTTCTTCAGAATG GGTGTAAGCCACTTGGTAGAAAATAAGATCTTCCAAAATTTCTTTCCAGACCTGTTCTCA TCACTACAAAATGACGAGCTGGTGGAAAGTTTTTGGATTAACAAGCCTTTTGGTCTCATA ATAGCTTGTCTGGGTATGTCCATTTCGTTAAATCAAGATTCTCAAAAACTATGGTTTATC TGTTGTACGAATTTGTATGCTAGCTCATCTAAACATGACAATGACTTTGACACTGAGGAC ATTTTGTCACAGACAGAGCAACATGATGTTTTTGCCTTGATTCTATTTTATTCTCTTCTA GTAATGTTGGAGAATAACATTCCTGTTTCTAATTCCATTAAAAAGTTCGATGTGTTTTCA ATGCTTCAAGATATTCTGAAGCCATTCACCGTGGCATCCTCCAGTTACCATTATTTGAAT AGTAAGGAAAATGCATGGTTCATATTCGATCTATGGGTCAATATCTTGCGCGATTCAAAC AACTTCAACAACGATTCTTTACTAATATTTGGTTGGTTCGTCAATCAAGAGTTTATTTCG TCTAATCCACTTAAGGACTTCATATACAAGGGACCGTCAATGTCCACTACTGACTTAACT TTAAAGCATATCAATATTTTGGCAGATTCCGCGTACGTGTATTTTATAATAAAGAAGACT TATCCGCAAGAGCTGCCATCTGATTTTAGAGTGCATGATTTGCTGGTTTACTTGAATGAA TGTTTCGTAATGCAGCAGCCGATCAAACCTGAAACTAGTGCAAACCCCTCTTTATTTGCG AACGTTATGAACGCCAGGATTACGGACTGCAAATCGAAAAGTAACTGGTTATTGTGGGAA ACGATTTGGTTCGAATTCATCAACAACTTGACTTTGAGAAATGGGACCACAAGGAACATA TGGTTCATTGATAACTTTCCACAGGTATCGACCTCGTGCTTACTTCATCATTCTTCCTCA TTTGTTGATGAAACCTTGATCACCACGAACTTATCAATCATATCAATGCTTCTTAATTTG AAGTCTTTCACGCTGGCATCTTTAAACCCAAGGAATATTCAGTTAATTACCGACATTGTC AGCTTCCAACTAAAATTGTTTTCATCGGAGTTAATTGCAAGCTCGGATGTTTCACCATCA CAAGTATCTCAATTACTAGTAAACCCCAATGTTCACCTAATGTTATATTTCTGGTTCGAT ACCATTTATGTACAACGTCAGAGCTACCTTTCATCAACAGAGAAAGAGGAATTTGAGAAG GTTGAAGTGTTTGTGAATGACTACATTATAACACACCAAAAGAACTTGGTGACAGACTTA CACTCCATTTTGTTCGATTTTTGGTCAGATTCCTTCATTGCTTACCATATACTACTGCAT GCTATTGTATCTTCATTAAGAGATAATATTCTTTACCCATACTTAATCTACTCCCCTCAC CTGAATGACCAGACGAAAGCATTGTTGACTGATATCTCTAATTGGTCTTGTTTTGCTCTT CAACAGCCGTTTCGCAAGACTTCAAGAGGTTCTTTATCTGGTGCTTCTGATATGAAATCG TTTTCAGTAGCATCATGTTTGCCACTCTCTCCTAATTTCCTAAAGAGAGATTCAAACTGT AATAAGATTCTCCTGCCCCCATTAGATATAAAAGCCATTGAACCTATCTCAACGAGTAAT TACACCTACGTGAACTCGGCCCCTAAGCAACAAGAGAAGGAACAACCATTGTTAAGGGCA ACAGGAAACAATATCAATTTAGTCCAAACAATAGTGGTCCCACCCCAGGTAAACATGGAA TCACAAGAATTCTCAGCTTCTTCAACTGACAATAAACAAAGTTAA

YGR067C-TAP tagging: Forward Primer: CAAGAATTCTCAGCTTCTTCAACTGACAATAAACAAAGTTCCATGGAAAAGAGAAGATG G/C 33.9% Tm 64.7 C

Reverse Primer: CTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTACGACTCACTATAGGGCGA G/C 33.9% Tm 65.4 C

Module 3 Link

Click here for more info.

Publications

  1. Goldbeter A and Koshland DE Jr. . pmid:6947258. PubMed HubMed [Paper1]
  2. JACOB F and MONOD J. . pmid:13718526. PubMed HubMed [Paper2]
    leave a comment about a paper here

  3. Mark Ptashne. A genetic switch. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2004. isbn:0879697164. [Book1]
All Medline abstracts: PubMed HubMed

Useful links

Personal tools