User:Katherine H. Loh: Difference between revisions
| Line 55: | Line 55: | ||
Do you have any experience in molecular biology (electrophoresis, PCR, etc)?<br> No | Do you have any experience in molecular biology (electrophoresis, PCR, etc)?<br> No | ||
===Anything else you would like us to know?=== | ===Anything else you would like us to know?=== | ||
Revision as of 20:02, 5 November 2008
I am a new member of OpenWetWare!
Contact Info
- Katherine H. Loh
- Massachusetts Institute of Technology
- Address 1
- Address 2
- City, State, Country etc.
- Email me through OpenWetWare
I work in the Your Lab at XYZ University. I learned about OpenWetWare from 20.109, and I've joined because 20.109.
Mod 2: Protein Engineering
Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’
Registration/Questionnaire: 20.109 Fall 2008
Last Name
Loh
First Name
Katherine
Preferred name
Katie
Course/Minor
20
Year of Graduation
2011
Telephone #
kloh AT mit DOT edu
Have you taken or are you taking...
7.05/5.07 (Biochemistry) no
7.06 (Cell Biology) no
7.02 (General Biology Lab) no
5.310 (General Chemistry Lab) no
Do you have any experience culturing cells (mammalian, yeast or microbial)?
Yes
Do you have any experience in molecular biology (electrophoresis, PCR, etc)?
No
Anything else you would like us to know?
Education
- Year, PhD, Institute
- Year, MS, Institute
- Year, BS, Institute
Research interests
- Interest 1
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
- JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
leave a comment about a paper here
- ISBN:0879697164
