User:Katherine H. Loh: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 44: | Line 44: | ||
===Email=== | ===Email=== | ||
kloh AT mit DOT edu | kloh AT mit DOT edu | ||
Revision as of 20:02, 5 November 2008
I am a new member of OpenWetWare!
Contact Info
- Katherine H. Loh
- Massachusetts Institute of Technology
- Address 1
- Address 2
- City, State, Country etc.
- Email me through OpenWetWare
I work in the Your Lab at XYZ University. I learned about OpenWetWare from 20.109, and I've joined because 20.109.
Mod 2: Protein Engineering
Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’
Registration/Questionnaire: 20.109 Fall 2008
Last Name
Loh
First Name
Katherine
Preferred name
Katie
Course/Minor
20
Year of Graduation
2011
Telephone #
kloh AT mit DOT edu
Anything else you would like us to know?
Education
- Year, PhD, Institute
- Year, MS, Institute
- Year, BS, Institute
Research interests
- Interest 1
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
- JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
leave a comment about a paper here
- ISBN:0879697164
