User:Katherine H. Loh: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 39: | Line 39: | ||
==Research interests== | ==Research interests== | ||
==Publications== | ==Publications== | ||
Revision as of 18:11, 9 November 2008
I am a new member of OpenWetWare!
Contact Info
- Katherine H. Loh
- Massachusetts Institute of Technology
- Address 1
- Address 2
- City, State, Country etc.
- Email me through OpenWetWare
Art/Biotechnology Exhibit
Current interactions between science and the public
Goals and summary
Plans
- Exhibit
- Timing diagram
- "Parts" and "devices"
- Laboratory
- First experimental steps
- Control experiment
Resources
Societal Impact
Mod 2: Protein Engineering
Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’
